FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637472_at:

>probe:Drosophila_2:1637472_at:672:581; Interrogation_Position=165; Antisense; TGGCGGTCTGGTTAGCATCCAGCCA
>probe:Drosophila_2:1637472_at:169:261; Interrogation_Position=190; Antisense; CACCGTGGTGGCGACAAGTACCTGC
>probe:Drosophila_2:1637472_at:180:107; Interrogation_Position=251; Antisense; AGAAATTCTATCTGGTTTCCGCACC
>probe:Drosophila_2:1637472_at:86:615; Interrogation_Position=302; Antisense; TGAAGCATCTGGTCTTGGGACGTCC
>probe:Drosophila_2:1637472_at:324:519; Interrogation_Position=343; Antisense; GTGGTGTTCATCAAGGCTCCAGCCG
>probe:Drosophila_2:1637472_at:66:629; Interrogation_Position=375; Antisense; TGCCAACGTGAAGTATTCCGCCGAG
>probe:Drosophila_2:1637472_at:697:9; Interrogation_Position=389; Antisense; ATTCCGCCGAGTTTGCGCCACAGGA
>probe:Drosophila_2:1637472_at:626:455; Interrogation_Position=448; Antisense; GATAACGATGTGGACGCCAGCGATA
>probe:Drosophila_2:1637472_at:377:311; Interrogation_Position=545; Antisense; CCAAGCAGGCGCAGCAGGAGATCCA
>probe:Drosophila_2:1637472_at:176:489; Interrogation_Position=576; Antisense; GTACGACAAGCTGGGAGGCACCAAC
>probe:Drosophila_2:1637472_at:633:567; Interrogation_Position=592; Antisense; GGCACCAACGAGTATCAGGAGGACA
>probe:Drosophila_2:1637472_at:580:605; Interrogation_Position=638; Antisense; TGATCGGCAGCCTCGATGGCCTGAA
>probe:Drosophila_2:1637472_at:148:307; Interrogation_Position=657; Antisense; CCTGAATCCCGATGGTAGCTACAAC
>probe:Drosophila_2:1637472_at:26:193; Interrogation_Position=721; Antisense; AACTCGCAGTATCTGCCCAGTTTGC

Paste this into a BLAST search page for me
TGGCGGTCTGGTTAGCATCCAGCCACACCGTGGTGGCGACAAGTACCTGCAGAAATTCTATCTGGTTTCCGCACCTGAAGCATCTGGTCTTGGGACGTCCGTGGTGTTCATCAAGGCTCCAGCCGTGCCAACGTGAAGTATTCCGCCGAGATTCCGCCGAGTTTGCGCCACAGGAGATAACGATGTGGACGCCAGCGATACCAAGCAGGCGCAGCAGGAGATCCAGTACGACAAGCTGGGAGGCACCAACGGCACCAACGAGTATCAGGAGGACATGATCGGCAGCCTCGATGGCCTGAACCTGAATCCCGATGGTAGCTACAACAACTCGCAGTATCTGCCCAGTTTGC

Full Affymetrix probeset data:

Annotations for 1637472_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720