Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637473_s_at:

>probe:Drosophila_2:1637473_s_at:547:391; Interrogation_Position=1195; Antisense; GAAATCCAGTCCTCAGTTTACAGTC
>probe:Drosophila_2:1637473_s_at:267:91; Interrogation_Position=1209; Antisense; AGTTTACAGTCGCATGGAGGATCTC
>probe:Drosophila_2:1637473_s_at:322:227; Interrogation_Position=1258; Antisense; AAGGCGGATCAATTTCTACCAGGTG
>probe:Drosophila_2:1637473_s_at:200:645; Interrogation_Position=1272; Antisense; TCTACCAGGTGCCTTGCCATTCAAA
>probe:Drosophila_2:1637473_s_at:513:221; Interrogation_Position=723; Antisense; AAGTGTCTTTGGACAGCCACAGCAG
>probe:Drosophila_2:1637473_s_at:11:127; Interrogation_Position=758; Antisense; AGCCTGCTGCACAAGCTTTCCAAGG
>probe:Drosophila_2:1637473_s_at:254:69; Interrogation_Position=800; Antisense; AGGCGCAGGTTCAGGTGCAAGCTCA
>probe:Drosophila_2:1637473_s_at:544:615; Interrogation_Position=815; Antisense; TGCAAGCTCAGCCAGTGAATCCTAA
>probe:Drosophila_2:1637473_s_at:522:85; Interrogation_Position=828; Antisense; AGTGAATCCTAATCCTTTCGGTGGT
>probe:Drosophila_2:1637473_s_at:538:43; Interrogation_Position=839; Antisense; ATCCTTTCGGTGGTTTCCAACAGCA
>probe:Drosophila_2:1637473_s_at:497:495; Interrogation_Position=879; Antisense; GTCGACGGGAATCTTTGGCCAAGCC
>probe:Drosophila_2:1637473_s_at:233:369; Interrogation_Position=923; Antisense; GAATGTTTACTCAGGCTTCTCAGCA
>probe:Drosophila_2:1637473_s_at:151:315; Interrogation_Position=973; Antisense; GCCTCCGGATTATTTGCTCAAGCAG
>probe:Drosophila_2:1637473_s_at:673:115; Interrogation_Position=999; Antisense; AGCATCTGCATTCCCTAATCAACAA

Paste this into a BLAST search page for me
GAAATCCAGTCCTCAGTTTACAGTCAGTTTACAGTCGCATGGAGGATCTCAAGGCGGATCAATTTCTACCAGGTGTCTACCAGGTGCCTTGCCATTCAAAAAGTGTCTTTGGACAGCCACAGCAGAGCCTGCTGCACAAGCTTTCCAAGGAGGCGCAGGTTCAGGTGCAAGCTCATGCAAGCTCAGCCAGTGAATCCTAAAGTGAATCCTAATCCTTTCGGTGGTATCCTTTCGGTGGTTTCCAACAGCAGTCGACGGGAATCTTTGGCCAAGCCGAATGTTTACTCAGGCTTCTCAGCAGCCTCCGGATTATTTGCTCAAGCAGAGCATCTGCATTCCCTAATCAACAA

Full Affymetrix probeset data:

Annotations for 1637473_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime