FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637474_at:

>probe:Drosophila_2:1637474_at:490:573; Interrogation_Position=108; Antisense; GGCTGAGCGAGGTTATTTCAAGCAA
>probe:Drosophila_2:1637474_at:684:169; Interrogation_Position=131; Antisense; AAAGTGTTGTGCATTTCCAGCTAGC
>probe:Drosophila_2:1637474_at:392:117; Interrogation_Position=149; Antisense; AGCTAGCGCCGCATATGGAAATTGC
>probe:Drosophila_2:1637474_at:719:395; Interrogation_Position=166; Antisense; GAAATTGCACTTCCTGGGAGTTTCG
>probe:Drosophila_2:1637474_at:536:583; Interrogation_Position=202; Antisense; TGGCACGCCCAGGATGGTTGCATAT
>probe:Drosophila_2:1637474_at:485:703; Interrogation_Position=234; Antisense; TTATTGCTGCTTTGTCTCGTGCCAA
>probe:Drosophila_2:1637474_at:243:483; Interrogation_Position=292; Antisense; GTATCCCTTCCTGGATCCAAGCGAG
>probe:Drosophila_2:1637474_at:643:275; Interrogation_Position=324; Antisense; CTTCCGAGATGTCCAACAGCTGATG
>probe:Drosophila_2:1637474_at:615:709; Interrogation_Position=33; Antisense; TTCCTCCGCGGAGCGAACAGGTAAC
>probe:Drosophila_2:1637474_at:62:495; Interrogation_Position=355; Antisense; GTCAATCTGCCGACAAGTTGCAACA
>probe:Drosophila_2:1637474_at:399:213; Interrogation_Position=410; Antisense; AAGAGAGATCCCCACCGATTTCATT
>probe:Drosophila_2:1637474_at:545:289; Interrogation_Position=425; Antisense; CGATTTCATTCCAAGGTTGCGCCTG
>probe:Drosophila_2:1637474_at:403:469; Interrogation_Position=440; Antisense; GTTGCGCCTGTTCACGATCAAAGGG
>probe:Drosophila_2:1637474_at:469:3; Interrogation_Position=469; Antisense; ATTGTGAGCTTCGAGTTTCGCCCAT

Paste this into a BLAST search page for me
GGCTGAGCGAGGTTATTTCAAGCAAAAAGTGTTGTGCATTTCCAGCTAGCAGCTAGCGCCGCATATGGAAATTGCGAAATTGCACTTCCTGGGAGTTTCGTGGCACGCCCAGGATGGTTGCATATTTATTGCTGCTTTGTCTCGTGCCAAGTATCCCTTCCTGGATCCAAGCGAGCTTCCGAGATGTCCAACAGCTGATGTTCCTCCGCGGAGCGAACAGGTAACGTCAATCTGCCGACAAGTTGCAACAAAGAGAGATCCCCACCGATTTCATTCGATTTCATTCCAAGGTTGCGCCTGGTTGCGCCTGTTCACGATCAAAGGGATTGTGAGCTTCGAGTTTCGCCCAT

Full Affymetrix probeset data:

Annotations for 1637474_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720