FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637475_at:

>probe:Drosophila_2:1637475_at:95:207; Interrogation_Position=1870; Antisense; AAGCGCAGCCTTATGAACACACTCA
>probe:Drosophila_2:1637475_at:195:615; Interrogation_Position=1955; Antisense; TGAAGAGCACCAAGTCGCCGCTGAA
>probe:Drosophila_2:1637475_at:358:333; Interrogation_Position=1974; Antisense; GCTGAAACGTGTTCGCGTACTGGAC
>probe:Drosophila_2:1637475_at:446:489; Interrogation_Position=1990; Antisense; GTACTGGACAACACACTGCGACGCA
>probe:Drosophila_2:1637475_at:25:471; Interrogation_Position=2048; Antisense; GTTCCAGCAAGAAGGCGCGCACCAA
>probe:Drosophila_2:1637475_at:652:367; Interrogation_Position=2124; Antisense; GAATCCCGAGCAGGGTGTCAGCTAT
>probe:Drosophila_2:1637475_at:250:53; Interrogation_Position=2147; Antisense; ATGACGAATTTCAGCCGACCAGTCG
>probe:Drosophila_2:1637475_at:399:325; Interrogation_Position=2214; Antisense; GCGAACTCGTCGTGCGGAAATGAAT
>probe:Drosophila_2:1637475_at:647:167; Interrogation_Position=2231; Antisense; AAATGAATGCCAATCTGCCGGTGCC
>probe:Drosophila_2:1637475_at:202:175; Interrogation_Position=2261; Antisense; AAAGCCTGATGATCGTGCAGCCGCG
>probe:Drosophila_2:1637475_at:182:323; Interrogation_Position=2283; Antisense; GCGCAGACAGTTCTAGTTCCACTGG
>probe:Drosophila_2:1637475_at:89:471; Interrogation_Position=2298; Antisense; GTTCCACTGGAGATTGACTAGCTTA
>probe:Drosophila_2:1637475_at:89:607; Interrogation_Position=2312; Antisense; TGACTAGCTTAACGCGTACCTACTA
>probe:Drosophila_2:1637475_at:86:609; Interrogation_Position=2418; Antisense; TGAGTTTTTTCGCTTGACCACAAGA

Paste this into a BLAST search page for me
AAGCGCAGCCTTATGAACACACTCATGAAGAGCACCAAGTCGCCGCTGAAGCTGAAACGTGTTCGCGTACTGGACGTACTGGACAACACACTGCGACGCAGTTCCAGCAAGAAGGCGCGCACCAAGAATCCCGAGCAGGGTGTCAGCTATATGACGAATTTCAGCCGACCAGTCGGCGAACTCGTCGTGCGGAAATGAATAAATGAATGCCAATCTGCCGGTGCCAAAGCCTGATGATCGTGCAGCCGCGGCGCAGACAGTTCTAGTTCCACTGGGTTCCACTGGAGATTGACTAGCTTATGACTAGCTTAACGCGTACCTACTATGAGTTTTTTCGCTTGACCACAAGA

Full Affymetrix probeset data:

Annotations for 1637475_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720