FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637477_at:

>probe:Drosophila_2:1637477_at:102:91; Interrogation_Position=413; Antisense; AGTACTGTGTCTCGGCCTCGGATAA
>probe:Drosophila_2:1637477_at:177:273; Interrogation_Position=463; Antisense; CTTACATCCTTCTCAGTGGTTCGAA
>probe:Drosophila_2:1637477_at:261:483; Interrogation_Position=510; Antisense; GTATAACTCAGATTTCTCGCGGGAT
>probe:Drosophila_2:1637477_at:182:443; Interrogation_Position=532; Antisense; GATGTGAGCTTTTTCGACGGGTTTC
>probe:Drosophila_2:1637477_at:77:691; Interrogation_Position=571; Antisense; TTTGTAGTGATCTTGGGCCACACGC
>probe:Drosophila_2:1637477_at:500:579; Interrogation_Position=586; Antisense; GGCCACACGCTTATGGTCTTTATGA
>probe:Drosophila_2:1637477_at:333:1; Interrogation_Position=651; Antisense; GTTCCGGTTCGAGACTTCAATATTT
>probe:Drosophila_2:1637477_at:151:571; Interrogation_Position=718; Antisense; GGCTTCCTTCTCTACGTGAAATTCA
>probe:Drosophila_2:1637477_at:340:619; Interrogation_Position=784; Antisense; TGCATTGCTGTGTACTTTCGAGTGT
>probe:Drosophila_2:1637477_at:236:95; Interrogation_Position=817; Antisense; AGATACTTTAGACTTCTGCCATCGC
>probe:Drosophila_2:1637477_at:258:229; Interrogation_Position=862; Antisense; AATGGAACACTGCTGGTGCGCCTTC
>probe:Drosophila_2:1637477_at:514:127; Interrogation_Position=894; Antisense; ACCCTTTTGGCGACATCTTACGGAG
>probe:Drosophila_2:1637477_at:214:715; Interrogation_Position=931; Antisense; TTCTGTCGCGCCAACTGGTGGAAGA
>probe:Drosophila_2:1637477_at:423:695; Interrogation_Position=963; Antisense; TTTCGTGACCAACCACATGCTGGAA

Paste this into a BLAST search page for me
AGTACTGTGTCTCGGCCTCGGATAACTTACATCCTTCTCAGTGGTTCGAAGTATAACTCAGATTTCTCGCGGGATGATGTGAGCTTTTTCGACGGGTTTCTTTGTAGTGATCTTGGGCCACACGCGGCCACACGCTTATGGTCTTTATGAGTTCCGGTTCGAGACTTCAATATTTGGCTTCCTTCTCTACGTGAAATTCATGCATTGCTGTGTACTTTCGAGTGTAGATACTTTAGACTTCTGCCATCGCAATGGAACACTGCTGGTGCGCCTTCACCCTTTTGGCGACATCTTACGGAGTTCTGTCGCGCCAACTGGTGGAAGATTTCGTGACCAACCACATGCTGGAA

Full Affymetrix probeset data:

Annotations for 1637477_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720