FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637479_at:

>probe:Drosophila_2:1637479_at:220:201; Interrogation_Position=1201; Antisense; AACGCGTCCAGCAAGCACTGATGGA
>probe:Drosophila_2:1637479_at:177:247; Interrogation_Position=1240; Antisense; AATTGGAGTTGCGACCTCACGAGGT
>probe:Drosophila_2:1637479_at:324:649; Interrogation_Position=1256; Antisense; TCACGAGGTGGACACCCGCTTTATG
>probe:Drosophila_2:1637479_at:225:681; Interrogation_Position=1277; Antisense; TATGGGCGGCTGCTTCTTGCGCCAA
>probe:Drosophila_2:1637479_at:603:47; Interrogation_Position=1329; Antisense; ATCCTGCCCATTGTTAAGCGAGCGC
>probe:Drosophila_2:1637479_at:47:229; Interrogation_Position=1360; Antisense; AATGGGAAGCGGATCACGCCTGCGA
>probe:Drosophila_2:1637479_at:622:33; Interrogation_Position=1372; Antisense; ATCACGCCTGCGATTGTGACGAGGT
>probe:Drosophila_2:1637479_at:436:407; Interrogation_Position=1389; Antisense; GACGAGGTGTACTTCTTCAAGGAGA
>probe:Drosophila_2:1637479_at:451:303; Interrogation_Position=1416; Antisense; CCGCAGCTGGGACTCTCTTAAGAAG
>probe:Drosophila_2:1637479_at:519:705; Interrogation_Position=1484; Antisense; TTAGCGCAACCGTTATGTTACCAAC
>probe:Drosophila_2:1637479_at:215:401; Interrogation_Position=1528; Antisense; GACATAGCGAATTTCCCATTTACGA
>probe:Drosophila_2:1637479_at:611:481; Interrogation_Position=1653; Antisense; GTATTCACACATTAAGCTCTATCCA
>probe:Drosophila_2:1637479_at:75:119; Interrogation_Position=1667; Antisense; AGCTCTATCCAGTTTCCTAGTTGTT
>probe:Drosophila_2:1637479_at:234:553; Interrogation_Position=1761; Antisense; GGACTACAACTGTGGCTCGGTATCG

Paste this into a BLAST search page for me
AACGCGTCCAGCAAGCACTGATGGAAATTGGAGTTGCGACCTCACGAGGTTCACGAGGTGGACACCCGCTTTATGTATGGGCGGCTGCTTCTTGCGCCAAATCCTGCCCATTGTTAAGCGAGCGCAATGGGAAGCGGATCACGCCTGCGAATCACGCCTGCGATTGTGACGAGGTGACGAGGTGTACTTCTTCAAGGAGACCGCAGCTGGGACTCTCTTAAGAAGTTAGCGCAACCGTTATGTTACCAACGACATAGCGAATTTCCCATTTACGAGTATTCACACATTAAGCTCTATCCAAGCTCTATCCAGTTTCCTAGTTGTTGGACTACAACTGTGGCTCGGTATCG

Full Affymetrix probeset data:

Annotations for 1637479_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720