Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637481_at:

>probe:Drosophila_2:1637481_at:307:235; Interrogation_Position=6614; Antisense; AATCCAGCACACTCTCTTTAGAAGG
>probe:Drosophila_2:1637481_at:447:221; Interrogation_Position=6635; Antisense; AAGGATTCACTTGGTTTAGACTGTA
>probe:Drosophila_2:1637481_at:378:167; Interrogation_Position=6752; Antisense; AAGATGCGTACCATTTTCCTACCAT
>probe:Drosophila_2:1637481_at:531:717; Interrogation_Position=6767; Antisense; TTCCTACCATCCTATGTTTAGTCGT
>probe:Drosophila_2:1637481_at:335:477; Interrogation_Position=6782; Antisense; GTTTAGTCGTAATCTTATCCTCATT
>probe:Drosophila_2:1637481_at:377:683; Interrogation_Position=6797; Antisense; TATCCTCATTAGTTAGTCTAGCTGT
>probe:Drosophila_2:1637481_at:153:3; Interrogation_Position=6833; Antisense; ATTGAATCCAAACCTACAATCCCCG
>probe:Drosophila_2:1637481_at:283:299; Interrogation_Position=6856; Antisense; CGCCTACCAGATACAGCCATATTAA
>probe:Drosophila_2:1637481_at:639:389; Interrogation_Position=6956; Antisense; GAAACACGAATTATGCAACACGAAT
>probe:Drosophila_2:1637481_at:716:165; Interrogation_Position=6999; Antisense; AAATCGACTGATTACATGTGTACTA
>probe:Drosophila_2:1637481_at:453:245; Interrogation_Position=7046; Antisense; AATTATGATTTACTCGCCGTTTGTT
>probe:Drosophila_2:1637481_at:505:143; Interrogation_Position=7057; Antisense; ACTCGCCGTTTGTTGTAAATATTGT
>probe:Drosophila_2:1637481_at:51:163; Interrogation_Position=7073; Antisense; AAATATTGTAACTACCCGCACACCT
>probe:Drosophila_2:1637481_at:492:147; Interrogation_Position=7083; Antisense; ACTACCCGCACACCTATGAATATGT

Paste this into a BLAST search page for me
AATCCAGCACACTCTCTTTAGAAGGAAGGATTCACTTGGTTTAGACTGTAAAGATGCGTACCATTTTCCTACCATTTCCTACCATCCTATGTTTAGTCGTGTTTAGTCGTAATCTTATCCTCATTTATCCTCATTAGTTAGTCTAGCTGTATTGAATCCAAACCTACAATCCCCGCGCCTACCAGATACAGCCATATTAAGAAACACGAATTATGCAACACGAATAAATCGACTGATTACATGTGTACTAAATTATGATTTACTCGCCGTTTGTTACTCGCCGTTTGTTGTAAATATTGTAAATATTGTAACTACCCGCACACCTACTACCCGCACACCTATGAATATGT

Full Affymetrix probeset data:

Annotations for 1637481_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime