FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637482_at:

>probe:Drosophila_2:1637482_at:360:63; Interrogation_Position=2802; Antisense; AGGCGGACAGCGAGGTTTCCCTGCC
>probe:Drosophila_2:1637482_at:171:133; Interrogation_Position=2865; Antisense; ACCCCAAGAGCGATGTGGATGCCCT
>probe:Drosophila_2:1637482_at:203:547; Interrogation_Position=2881; Antisense; GGATGCCCTGCTCAAATGAGCCATT
>probe:Drosophila_2:1637482_at:596:415; Interrogation_Position=2898; Antisense; GAGCCATTGCCATGCATTAATTTGT
>probe:Drosophila_2:1637482_at:152:713; Interrogation_Position=2929; Antisense; TTCTCTAGTGTAAATACTCGCCAAG
>probe:Drosophila_2:1637482_at:89:253; Interrogation_Position=2950; Antisense; CAAGATTTAGATGTCGAACCGCAAT
>probe:Drosophila_2:1637482_at:678:25; Interrogation_Position=2988; Antisense; ATAGCTCCTTTTTCTTCTCGATGTT
>probe:Drosophila_2:1637482_at:549:695; Interrogation_Position=3043; Antisense; TTTAAGCGCCATTTTGACCGGAAGC
>probe:Drosophila_2:1637482_at:269:633; Interrogation_Position=3073; Antisense; TCCGCCGCTCCAATTGTATTTGATT
>probe:Drosophila_2:1637482_at:608:611; Interrogation_Position=3150; Antisense; TGAACGCCTTGTAAATACGCCACGC
>probe:Drosophila_2:1637482_at:470:449; Interrogation_Position=3189; Antisense; GATCGCATTGCAGCCAAATATCGTG
>probe:Drosophila_2:1637482_at:316:219; Interrogation_Position=3268; Antisense; AAGTCATAAGCTAGGGCACCACCAG
>probe:Drosophila_2:1637482_at:478:525; Interrogation_Position=3281; Antisense; GGGCACCACCAGATAGCAATTGAAT
>probe:Drosophila_2:1637482_at:414:91; Interrogation_Position=3324; Antisense; AGTTTCTTCGATTTTTTGATTCACA

Paste this into a BLAST search page for me
AGGCGGACAGCGAGGTTTCCCTGCCACCCCAAGAGCGATGTGGATGCCCTGGATGCCCTGCTCAAATGAGCCATTGAGCCATTGCCATGCATTAATTTGTTTCTCTAGTGTAAATACTCGCCAAGCAAGATTTAGATGTCGAACCGCAATATAGCTCCTTTTTCTTCTCGATGTTTTTAAGCGCCATTTTGACCGGAAGCTCCGCCGCTCCAATTGTATTTGATTTGAACGCCTTGTAAATACGCCACGCGATCGCATTGCAGCCAAATATCGTGAAGTCATAAGCTAGGGCACCACCAGGGGCACCACCAGATAGCAATTGAATAGTTTCTTCGATTTTTTGATTCACA

Full Affymetrix probeset data:

Annotations for 1637482_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720