FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637483_at:

>probe:Drosophila_2:1637483_at:574:47; Interrogation_Position=242; Antisense; ATCCGGCTGGCGTGAATCCGCAGGA
>probe:Drosophila_2:1637483_at:622:189; Interrogation_Position=274; Antisense; AACTTCCCCATCTGTGATAATGCGC
>probe:Drosophila_2:1637483_at:54:41; Interrogation_Position=283; Antisense; ATCTGTGATAATGCGCGCCTGCACA
>probe:Drosophila_2:1637483_at:349:83; Interrogation_Position=365; Antisense; AGTGGAACCCGCAGCCACAGTGGCA
>probe:Drosophila_2:1637483_at:708:83; Interrogation_Position=428; Antisense; AGTGGCAGGCACAGCCCTCGTGGAA
>probe:Drosophila_2:1637483_at:104:355; Interrogation_Position=469; Antisense; GCACCCGGTGGCGATAAGTATCCAG
>probe:Drosophila_2:1637483_at:171:659; Interrogation_Position=483; Antisense; TAAGTATCCAGCTGGCGTCAATCCG
>probe:Drosophila_2:1637483_at:174:193; Interrogation_Position=520; Antisense; AACTATCCCTACTGCGACGTGAACG
>probe:Drosophila_2:1637483_at:581:643; Interrogation_Position=579; Antisense; TCTACCTGGCTGGACGGAGCGTCTG
>probe:Drosophila_2:1637483_at:247:417; Interrogation_Position=595; Antisense; GAGCGTCTGTATCCCGCCGGAGTTT
>probe:Drosophila_2:1637483_at:606:187; Interrogation_Position=637; Antisense; AACTTCCCGTACTGCAACTAGGGCG
>probe:Drosophila_2:1637483_at:4:147; Interrogation_Position=652; Antisense; AACTAGGGCGGCCTAGGGCTCACTT
>probe:Drosophila_2:1637483_at:274:273; Interrogation_Position=709; Antisense; CTTTCCCCAGTTCTCAATTAGTGGA
>probe:Drosophila_2:1637483_at:44:247; Interrogation_Position=745; Antisense; AATTCTTTGTTGTTGGCGCCGAAAT

Paste this into a BLAST search page for me
ATCCGGCTGGCGTGAATCCGCAGGAAACTTCCCCATCTGTGATAATGCGCATCTGTGATAATGCGCGCCTGCACAAGTGGAACCCGCAGCCACAGTGGCAAGTGGCAGGCACAGCCCTCGTGGAAGCACCCGGTGGCGATAAGTATCCAGTAAGTATCCAGCTGGCGTCAATCCGAACTATCCCTACTGCGACGTGAACGTCTACCTGGCTGGACGGAGCGTCTGGAGCGTCTGTATCCCGCCGGAGTTTAACTTCCCGTACTGCAACTAGGGCGAACTAGGGCGGCCTAGGGCTCACTTCTTTCCCCAGTTCTCAATTAGTGGAAATTCTTTGTTGTTGGCGCCGAAAT

Full Affymetrix probeset data:

Annotations for 1637483_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720