Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637484_at:

>probe:Drosophila_2:1637484_at:566:475; Interrogation_Position=1148; Antisense; GTTATAGTTTGGACCATGCGCAGCT
>probe:Drosophila_2:1637484_at:154:51; Interrogation_Position=1163; Antisense; ATGCGCAGCTAGATGGTCCCCAAAA
>probe:Drosophila_2:1637484_at:269:149; Interrogation_Position=1193; Antisense; ACTTATTTAATTCTCTTGCCGATGG
>probe:Drosophila_2:1637484_at:604:127; Interrogation_Position=1221; Antisense; ACCAATGATTGGCTTGATTTTGACC
>probe:Drosophila_2:1637484_at:698:15; Interrogation_Position=1237; Antisense; ATTTTGACCAGTGACTTGTCGGCGC
>probe:Drosophila_2:1637484_at:598:279; Interrogation_Position=1268; Antisense; CTCTTCGCTGCAAACACCTAATTAT
>probe:Drosophila_2:1637484_at:261:685; Interrogation_Position=1294; Antisense; TATAATCACAATTCCAGGCAGCAAG
>probe:Drosophila_2:1637484_at:312:195; Interrogation_Position=1325; Antisense; AACTGCTGGCCGTTGGAGCAATGGA
>probe:Drosophila_2:1637484_at:441:243; Interrogation_Position=1356; Antisense; AATATATACTCTCATCACAGCCGGA
>probe:Drosophila_2:1637484_at:326:643; Interrogation_Position=1384; Antisense; TCTCCGGAGGAGTTGCAGTTCTATG
>probe:Drosophila_2:1637484_at:445:215; Interrogation_Position=1433; Antisense; AAGATCTTCAGAATTGCCGCAGCCA
>probe:Drosophila_2:1637484_at:233:117; Interrogation_Position=1457; Antisense; AGCTTATACCGACCGCATCTAATAA
>probe:Drosophila_2:1637484_at:720:655; Interrogation_Position=1479; Antisense; TAATCTAGCGGACTGGACCAAAAGT
>probe:Drosophila_2:1637484_at:11:171; Interrogation_Position=1499; Antisense; AAAGTGAGCCACCTTTTGACCGTGT

Paste this into a BLAST search page for me
GTTATAGTTTGGACCATGCGCAGCTATGCGCAGCTAGATGGTCCCCAAAAACTTATTTAATTCTCTTGCCGATGGACCAATGATTGGCTTGATTTTGACCATTTTGACCAGTGACTTGTCGGCGCCTCTTCGCTGCAAACACCTAATTATTATAATCACAATTCCAGGCAGCAAGAACTGCTGGCCGTTGGAGCAATGGAAATATATACTCTCATCACAGCCGGATCTCCGGAGGAGTTGCAGTTCTATGAAGATCTTCAGAATTGCCGCAGCCAAGCTTATACCGACCGCATCTAATAATAATCTAGCGGACTGGACCAAAAGTAAAGTGAGCCACCTTTTGACCGTGT

Full Affymetrix probeset data:

Annotations for 1637484_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime