FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637485_at:

>probe:Drosophila_2:1637485_at:131:203; Interrogation_Position=1115; Antisense; AACCAGGCGCGTATGGCTCTGAATG
>probe:Drosophila_2:1637485_at:392:147; Interrogation_Position=1142; Antisense; ACTATTGAGTTCTCCAAGGCCATCG
>probe:Drosophila_2:1637485_at:236:419; Interrogation_Position=1178; Antisense; GAGCTGACCAGCGAGGATGACACCT
>probe:Drosophila_2:1637485_at:414:63; Interrogation_Position=1230; Antisense; ATGTGTTCACCTACGCAGGATACTC
>probe:Drosophila_2:1637485_at:550:75; Interrogation_Position=1246; Antisense; AGGATACTCGTACCGTGGATCTGAT
>probe:Drosophila_2:1637485_at:584:65; Interrogation_Position=1316; Antisense; ATGGTTCTAAGCTACGCCAACGGAC
>probe:Drosophila_2:1637485_at:448:669; Interrogation_Position=1346; Antisense; TACGAGAATTTCTACGACGCGGAGA
>probe:Drosophila_2:1637485_at:371:137; Interrogation_Position=1413; Antisense; ACGACGATGAGTTTCCCTCGGGTGT
>probe:Drosophila_2:1637485_at:708:43; Interrogation_Position=1442; Antisense; ATCGACATGGACTCGCACGGAGGCG
>probe:Drosophila_2:1637485_at:730:671; Interrogation_Position=1520; Antisense; TACGAACAGAGCACCATTCCGCATA
>probe:Drosophila_2:1637485_at:175:11; Interrogation_Position=1535; Antisense; ATTCCGCATATGATGGCCTACGCAT
>probe:Drosophila_2:1637485_at:191:595; Interrogation_Position=1566; Antisense; TGGGCGACGGTCATACCATGTGCAA
>probe:Drosophila_2:1637485_at:435:441; Interrogation_Position=1607; Antisense; GATGGTGCAAGGTTGCCATGCCGCC
>probe:Drosophila_2:1637485_at:406:269; Interrogation_Position=1623; Antisense; CATGCCGCCTGGTTGTAACAATTAA

Paste this into a BLAST search page for me
AACCAGGCGCGTATGGCTCTGAATGACTATTGAGTTCTCCAAGGCCATCGGAGCTGACCAGCGAGGATGACACCTATGTGTTCACCTACGCAGGATACTCAGGATACTCGTACCGTGGATCTGATATGGTTCTAAGCTACGCCAACGGACTACGAGAATTTCTACGACGCGGAGAACGACGATGAGTTTCCCTCGGGTGTATCGACATGGACTCGCACGGAGGCGTACGAACAGAGCACCATTCCGCATAATTCCGCATATGATGGCCTACGCATTGGGCGACGGTCATACCATGTGCAAGATGGTGCAAGGTTGCCATGCCGCCCATGCCGCCTGGTTGTAACAATTAA

Full Affymetrix probeset data:

Annotations for 1637485_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720