FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637486_at:

>probe:Drosophila_2:1637486_at:238:621; Interrogation_Position=176; Antisense; TGCGGTGCCCATTGCGTCTACAATG
>probe:Drosophila_2:1637486_at:695:327; Interrogation_Position=189; Antisense; GCGTCTACAATGGTCCAAGTTGTCA
>probe:Drosophila_2:1637486_at:184:251; Interrogation_Position=204; Antisense; CAAGTTGTCAAAATCCCGGTCCCTG
>probe:Drosophila_2:1637486_at:652:25; Interrogation_Position=23; Antisense; ATACGAGTTCTGCTGATTTTCCAAC
>probe:Drosophila_2:1637486_at:74:177; Interrogation_Position=236; Antisense; AAACCCGTGAATCGTTGCATCCTGG
>probe:Drosophila_2:1637486_at:678:345; Interrogation_Position=252; Antisense; GCATCCTGGACTCACATTGTGGCAA
>probe:Drosophila_2:1637486_at:14:487; Interrogation_Position=281; Antisense; GTAGCCTTCTACTTCGTATGCAAGT
>probe:Drosophila_2:1637486_at:46:225; Interrogation_Position=323; Antisense; AAGGAAAATGAAGCTCGCCAGGCAG
>probe:Drosophila_2:1637486_at:251:73; Interrogation_Position=342; Antisense; AGGCAGCTGGATATGCCCGTCTTCT
>probe:Drosophila_2:1637486_at:45:319; Interrogation_Position=356; Antisense; GCCCGTCTTCTTTCATTTTCGTGGG
>probe:Drosophila_2:1637486_at:700:15; Interrogation_Position=38; Antisense; ATTTTCCAACTGCTGGCTTGTCTAA
>probe:Drosophila_2:1637486_at:347:469; Interrogation_Position=426; Antisense; GTTGCTGTCGTGAGTATTGTCCTAA
>probe:Drosophila_2:1637486_at:209:69; Interrogation_Position=62; Antisense; ATGGCCGTAATATCGGGCTGCAACC
>probe:Drosophila_2:1637486_at:177:315; Interrogation_Position=96; Antisense; GCCATCCGTTCATTGGCCTGAACAA

Paste this into a BLAST search page for me
TGCGGTGCCCATTGCGTCTACAATGGCGTCTACAATGGTCCAAGTTGTCACAAGTTGTCAAAATCCCGGTCCCTGATACGAGTTCTGCTGATTTTCCAACAAACCCGTGAATCGTTGCATCCTGGGCATCCTGGACTCACATTGTGGCAAGTAGCCTTCTACTTCGTATGCAAGTAAGGAAAATGAAGCTCGCCAGGCAGAGGCAGCTGGATATGCCCGTCTTCTGCCCGTCTTCTTTCATTTTCGTGGGATTTTCCAACTGCTGGCTTGTCTAAGTTGCTGTCGTGAGTATTGTCCTAAATGGCCGTAATATCGGGCTGCAACCGCCATCCGTTCATTGGCCTGAACAA

Full Affymetrix probeset data:

Annotations for 1637486_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720