Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637487_at:

>probe:Drosophila_2:1637487_at:295:591; Interrogation_Position=1171; Antisense; TGGTACATGCAATCGCTGATCCGCG
>probe:Drosophila_2:1637487_at:539:605; Interrogation_Position=1187; Antisense; TGATCCGCGAGCTGAACGCCAATGG
>probe:Drosophila_2:1637487_at:213:343; Interrogation_Position=1236; Antisense; GCTTACATTCGTTAACCAGCGCGTA
>probe:Drosophila_2:1637487_at:421:261; Interrogation_Position=1252; Antisense; CAGCGCGTAGCCCTAGACTTTGAGT
>probe:Drosophila_2:1637487_at:599:673; Interrogation_Position=1265; Antisense; TAGACTTTGAGTCGAACGTGCCCGC
>probe:Drosophila_2:1637487_at:289:573; Interrogation_Position=1383; Antisense; GGCTGGCTAGGAAGAGATCTCCCTT
>probe:Drosophila_2:1637487_at:355:635; Interrogation_Position=1442; Antisense; TCGCCCGCAATCATTCACGTTGGAT
>probe:Drosophila_2:1637487_at:343:465; Interrogation_Position=1460; Antisense; GTTGGATTCCAATTCACTTCAAGTT
>probe:Drosophila_2:1637487_at:423:477; Interrogation_Position=1482; Antisense; GTTTAGTTTTAGCTGACGCGTGCGA
>probe:Drosophila_2:1637487_at:278:135; Interrogation_Position=1497; Antisense; ACGCGTGCGATTATCCCGATGGATA
>probe:Drosophila_2:1637487_at:208:295; Interrogation_Position=1513; Antisense; CGATGGATATTGAAGCACCCGACTC
>probe:Drosophila_2:1637487_at:575:295; Interrogation_Position=1568; Antisense; CCCATTTCGGCCTTATCATTGACGA
>probe:Drosophila_2:1637487_at:519:693; Interrogation_Position=1607; Antisense; TTACCCACTAGATGACTTCCGTATG
>probe:Drosophila_2:1637487_at:194:485; Interrogation_Position=1627; Antisense; GTATGCATAAGCGAGACCTTGCCAA

Paste this into a BLAST search page for me
TGGTACATGCAATCGCTGATCCGCGTGATCCGCGAGCTGAACGCCAATGGGCTTACATTCGTTAACCAGCGCGTACAGCGCGTAGCCCTAGACTTTGAGTTAGACTTTGAGTCGAACGTGCCCGCGGCTGGCTAGGAAGAGATCTCCCTTTCGCCCGCAATCATTCACGTTGGATGTTGGATTCCAATTCACTTCAAGTTGTTTAGTTTTAGCTGACGCGTGCGAACGCGTGCGATTATCCCGATGGATACGATGGATATTGAAGCACCCGACTCCCCATTTCGGCCTTATCATTGACGATTACCCACTAGATGACTTCCGTATGGTATGCATAAGCGAGACCTTGCCAA

Full Affymetrix probeset data:

Annotations for 1637487_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime