Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637488_at:

>probe:Drosophila_2:1637488_at:19:485; Interrogation_Position=5422; Antisense; GTATCCGAGGTGCTCAAACTGATTG
>probe:Drosophila_2:1637488_at:321:465; Interrogation_Position=5442; Antisense; GATTGACTCGCACATCGAAAGCCTG
>probe:Drosophila_2:1637488_at:466:663; Interrogation_Position=5478; Antisense; TAAAGAGCTCAACGTGCTGGACACG
>probe:Drosophila_2:1637488_at:236:293; Interrogation_Position=5542; Antisense; CGAGGTCCTTTATTCGTGTGGCTGA
>probe:Drosophila_2:1637488_at:488:517; Interrogation_Position=5557; Antisense; GTGTGGCTGATTTTCACCAACCTCT
>probe:Drosophila_2:1637488_at:720:695; Interrogation_Position=5581; Antisense; TTTCTGGCCACTCTACTGGTAGTCA
>probe:Drosophila_2:1637488_at:409:539; Interrogation_Position=5598; Antisense; GGTAGTCACTATAGCACTTTGCGCC
>probe:Drosophila_2:1637488_at:140:695; Interrogation_Position=5615; Antisense; TTTGCGCCTCTCAACGGAATGGATA
>probe:Drosophila_2:1637488_at:210:349; Interrogation_Position=5642; Antisense; GCAGGCAGCTGAGAGCCGCTAAAGT
>probe:Drosophila_2:1637488_at:610:243; Interrogation_Position=5668; Antisense; AATATATTCCGTGGTCACTCCTCGA
>probe:Drosophila_2:1637488_at:697:441; Interrogation_Position=5691; Antisense; GATGTCCCTGCAAGACGCTCAGGAG
>probe:Drosophila_2:1637488_at:498:531; Interrogation_Position=5827; Antisense; GGTGGCCATGACTCTTTGGATGATA
>probe:Drosophila_2:1637488_at:126:175; Interrogation_Position=5885; Antisense; AAACGCTCAAGGGAACTGCCAAACT
>probe:Drosophila_2:1637488_at:434:233; Interrogation_Position=5977; Antisense; AATGCTCAGATCCTGGCCCGAAAAC

Paste this into a BLAST search page for me
GTATCCGAGGTGCTCAAACTGATTGGATTGACTCGCACATCGAAAGCCTGTAAAGAGCTCAACGTGCTGGACACGCGAGGTCCTTTATTCGTGTGGCTGAGTGTGGCTGATTTTCACCAACCTCTTTTCTGGCCACTCTACTGGTAGTCAGGTAGTCACTATAGCACTTTGCGCCTTTGCGCCTCTCAACGGAATGGATAGCAGGCAGCTGAGAGCCGCTAAAGTAATATATTCCGTGGTCACTCCTCGAGATGTCCCTGCAAGACGCTCAGGAGGGTGGCCATGACTCTTTGGATGATAAAACGCTCAAGGGAACTGCCAAACTAATGCTCAGATCCTGGCCCGAAAAC

Full Affymetrix probeset data:

Annotations for 1637488_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime