Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637489_at:

>probe:Drosophila_2:1637489_at:109:277; Interrogation_Position=1894; Antisense; CTTCATGGGCGCCAGCAGGAGAATC
>probe:Drosophila_2:1637489_at:131:607; Interrogation_Position=1944; Antisense; TGATGCTCAATTGCACTGATCCCAC
>probe:Drosophila_2:1637489_at:717:299; Interrogation_Position=1974; Antisense; CGCCGTCGACTCACGAACTGAAGAA
>probe:Drosophila_2:1637489_at:105:561; Interrogation_Position=1999; Antisense; GGAAACCCAGGAGCGCTGCAAGGAA
>probe:Drosophila_2:1637489_at:57:595; Interrogation_Position=2031; Antisense; TGGGCAGCTGCATACTTAAGTACGT
>probe:Drosophila_2:1637489_at:542:553; Interrogation_Position=2056; Antisense; GGACCAGCGGTTTACGTTGTACACG
>probe:Drosophila_2:1637489_at:232:499; Interrogation_Position=2103; Antisense; GTCTGCGCGCCTATGTCCAAAAGGA
>probe:Drosophila_2:1637489_at:21:407; Interrogation_Position=2148; Antisense; GACTGCTGGGCGCTGATCTCAGCAA
>probe:Drosophila_2:1637489_at:169:253; Interrogation_Position=2239; Antisense; CAAGAGTGCCGAGGCCGAAGCCGAT
>probe:Drosophila_2:1637489_at:453:141; Interrogation_Position=2285; Antisense; ACGGAGTCCACATTCTCTGGCAGTG
>probe:Drosophila_2:1637489_at:677:713; Interrogation_Position=2297; Antisense; TTCTCTGGCAGTGGCGCTATTGATG
>probe:Drosophila_2:1637489_at:364:691; Interrogation_Position=2314; Antisense; TATTGATGTCACAGTGGCCGCCGAG
>probe:Drosophila_2:1637489_at:40:269; Interrogation_Position=2343; Antisense; CAGGCACACCAATGGACACCGAAGT
>probe:Drosophila_2:1637489_at:494:261; Interrogation_Position=2374; Antisense; CACCAGTTAGTGTTTGTCGGGAGTA

Paste this into a BLAST search page for me
CTTCATGGGCGCCAGCAGGAGAATCTGATGCTCAATTGCACTGATCCCACCGCCGTCGACTCACGAACTGAAGAAGGAAACCCAGGAGCGCTGCAAGGAATGGGCAGCTGCATACTTAAGTACGTGGACCAGCGGTTTACGTTGTACACGGTCTGCGCGCCTATGTCCAAAAGGAGACTGCTGGGCGCTGATCTCAGCAACAAGAGTGCCGAGGCCGAAGCCGATACGGAGTCCACATTCTCTGGCAGTGTTCTCTGGCAGTGGCGCTATTGATGTATTGATGTCACAGTGGCCGCCGAGCAGGCACACCAATGGACACCGAAGTCACCAGTTAGTGTTTGTCGGGAGTA

Full Affymetrix probeset data:

Annotations for 1637489_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime