Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637490_at:

>probe:Drosophila_2:1637490_at:190:593; Interrogation_Position=104; Antisense; TGGGTCTGCCGGTTGCGCACGCTTA
>probe:Drosophila_2:1637490_at:126:381; Interrogation_Position=130; Antisense; GAACCGGCCAATCCGTACCAGGGAT
>probe:Drosophila_2:1637490_at:697:529; Interrogation_Position=150; Antisense; GGGATATGCAACAGCCGATGCCCAT
>probe:Drosophila_2:1637490_at:264:51; Interrogation_Position=191; Antisense; ATGCCCAGTGGGAGTCTGAGTTGCC
>probe:Drosophila_2:1637490_at:649:119; Interrogation_Position=221; Antisense; AGCTGTCGAAGAGTGCGCGGTTCTA
>probe:Drosophila_2:1637490_at:288:323; Interrogation_Position=235; Antisense; GCGCGGTTCTACAATGATCCCGTGA
>probe:Drosophila_2:1637490_at:598:605; Interrogation_Position=257; Antisense; TGATCGCTGCCAATCTGGCCAAGGA
>probe:Drosophila_2:1637490_at:563:579; Interrogation_Position=273; Antisense; GGCCAAGGAATCACTGCTCACGAAG
>probe:Drosophila_2:1637490_at:230:219; Interrogation_Position=29; Antisense; AAGTAACGCTGCTCGCTGGATGCCT
>probe:Drosophila_2:1637490_at:37:167; Interrogation_Position=302; Antisense; AAATGGCAGTGGTACATCGTGAGGC
>probe:Drosophila_2:1637490_at:374:163; Interrogation_Position=332; Antisense; AAATACCGCGCGAACAGGTGTACAA
>probe:Drosophila_2:1637490_at:182:665; Interrogation_Position=352; Antisense; TACAAGCTCTTCAAGAACGCCGGCT
>probe:Drosophila_2:1637490_at:423:381; Interrogation_Position=366; Antisense; GAACGCCGGCTATCTGAGTAGCAGA
>probe:Drosophila_2:1637490_at:729:267; Interrogation_Position=63; Antisense; CATGAGTTCGGTTCGGGCCCAGTTC

Paste this into a BLAST search page for me
TGGGTCTGCCGGTTGCGCACGCTTAGAACCGGCCAATCCGTACCAGGGATGGGATATGCAACAGCCGATGCCCATATGCCCAGTGGGAGTCTGAGTTGCCAGCTGTCGAAGAGTGCGCGGTTCTAGCGCGGTTCTACAATGATCCCGTGATGATCGCTGCCAATCTGGCCAAGGAGGCCAAGGAATCACTGCTCACGAAGAAGTAACGCTGCTCGCTGGATGCCTAAATGGCAGTGGTACATCGTGAGGCAAATACCGCGCGAACAGGTGTACAATACAAGCTCTTCAAGAACGCCGGCTGAACGCCGGCTATCTGAGTAGCAGACATGAGTTCGGTTCGGGCCCAGTTC

Full Affymetrix probeset data:

Annotations for 1637490_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime