FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637492_at:

>probe:Drosophila_2:1637492_at:334:375; Interrogation_Position=270; Antisense; GAAGATTCGTGTGGGCAGCACCTAC
>probe:Drosophila_2:1637492_at:635:493; Interrogation_Position=367; Antisense; GTCAACGACATTGCTATTATTCGCA
>probe:Drosophila_2:1637492_at:343:15; Interrogation_Position=382; Antisense; ATTATTCGCATCGAGTCCGATCTGA
>probe:Drosophila_2:1637492_at:395:629; Interrogation_Position=415; Antisense; TCCAGCATTCGCGAGATCCGTATTG
>probe:Drosophila_2:1637492_at:299:325; Interrogation_Position=425; Antisense; GCGAGATCCGTATTGCCGACTCCAA
>probe:Drosophila_2:1637492_at:127:585; Interrogation_Position=504; Antisense; TGGCAGCACCATTCCCGATCATCTG
>probe:Drosophila_2:1637492_at:635:271; Interrogation_Position=523; Antisense; CATCTGCTGGCCGTTGATCTGGAGA
>probe:Drosophila_2:1637492_at:433:97; Interrogation_Position=545; Antisense; AGATCATCGATGTGTCGCGTTGCCG
>probe:Drosophila_2:1637492_at:711:469; Interrogation_Position=563; Antisense; GTTGCCGCTCGGATGAGTTCGGATA
>probe:Drosophila_2:1637492_at:611:33; Interrogation_Position=598; Antisense; ATCAAGGACACCATGCTCTGCGCCT
>probe:Drosophila_2:1637492_at:27:425; Interrogation_Position=677; Antisense; GAGACCGCCTTGTCGGTGTTGTGTC
>probe:Drosophila_2:1637492_at:62:605; Interrogation_Position=720; Antisense; TGATGTGAGGTATCCCGGTGTCTAC
>probe:Drosophila_2:1637492_at:669:721; Interrogation_Position=752; Antisense; TTGCCCACTTCCACGAGTGGATCGA
>probe:Drosophila_2:1637492_at:638:131; Interrogation_Position=781; Antisense; ACCGCCGAGGAGGTGTAAAGCCAGA

Paste this into a BLAST search page for me
GAAGATTCGTGTGGGCAGCACCTACGTCAACGACATTGCTATTATTCGCAATTATTCGCATCGAGTCCGATCTGATCCAGCATTCGCGAGATCCGTATTGGCGAGATCCGTATTGCCGACTCCAATGGCAGCACCATTCCCGATCATCTGCATCTGCTGGCCGTTGATCTGGAGAAGATCATCGATGTGTCGCGTTGCCGGTTGCCGCTCGGATGAGTTCGGATAATCAAGGACACCATGCTCTGCGCCTGAGACCGCCTTGTCGGTGTTGTGTCTGATGTGAGGTATCCCGGTGTCTACTTGCCCACTTCCACGAGTGGATCGAACCGCCGAGGAGGTGTAAAGCCAGA

Full Affymetrix probeset data:

Annotations for 1637492_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720