FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637494_at:

>probe:Drosophila_2:1637494_at:393:57; Interrogation_Position=1325; Antisense; ATGAGGCAGCGCTTGTCCGATTCAT
>probe:Drosophila_2:1637494_at:400:43; Interrogation_Position=1348; Antisense; ATCGACTTCATTTGCAACCACTTGG
>probe:Drosophila_2:1637494_at:608:127; Interrogation_Position=1364; Antisense; ACCACTTGGGCGAGGTGCGATTCAT
>probe:Drosophila_2:1637494_at:79:535; Interrogation_Position=1416; Antisense; GGTCCTTGATGTCTTCGAGCAACGA
>probe:Drosophila_2:1637494_at:379:421; Interrogation_Position=1432; Antisense; GAGCAACGATTGGTGGCCTACAGCC
>probe:Drosophila_2:1637494_at:215:393; Interrogation_Position=1467; Antisense; GAAAGCCTTGCAACGATTGTCACTT
>probe:Drosophila_2:1637494_at:193:241; Interrogation_Position=1576; Antisense; AATAGCGAGGTAGCCCATAAGCCCA
>probe:Drosophila_2:1637494_at:353:255; Interrogation_Position=1613; Antisense; CAAAGACACCTAAGATGCATCCCTC
>probe:Drosophila_2:1637494_at:49:575; Interrogation_Position=1641; Antisense; GGCGGCGCAAAATTATGTGGTCTTA
>probe:Drosophila_2:1637494_at:58:645; Interrogation_Position=1661; Antisense; TCTTAGTTGAGTGACCCAGGCCGAC
>probe:Drosophila_2:1637494_at:614:349; Interrogation_Position=1753; Antisense; GCAGTTTCAATACCCATTACGCATG
>probe:Drosophila_2:1637494_at:101:233; Interrogation_Position=1810; Antisense; AATGAACGTTTCGTCGTGCATGCCA
>probe:Drosophila_2:1637494_at:81:501; Interrogation_Position=1822; Antisense; GTCGTGCATGCCAATTTCAGTTTTG
>probe:Drosophila_2:1637494_at:424:601; Interrogation_Position=1857; Antisense; TGAAATTTTGTCTGCCGTTTTACGC

Paste this into a BLAST search page for me
ATGAGGCAGCGCTTGTCCGATTCATATCGACTTCATTTGCAACCACTTGGACCACTTGGGCGAGGTGCGATTCATGGTCCTTGATGTCTTCGAGCAACGAGAGCAACGATTGGTGGCCTACAGCCGAAAGCCTTGCAACGATTGTCACTTAATAGCGAGGTAGCCCATAAGCCCACAAAGACACCTAAGATGCATCCCTCGGCGGCGCAAAATTATGTGGTCTTATCTTAGTTGAGTGACCCAGGCCGACGCAGTTTCAATACCCATTACGCATGAATGAACGTTTCGTCGTGCATGCCAGTCGTGCATGCCAATTTCAGTTTTGTGAAATTTTGTCTGCCGTTTTACGC

Full Affymetrix probeset data:

Annotations for 1637494_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720