FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637495_at:

>probe:Drosophila_2:1637495_at:586:551; Interrogation_Position=1030; Antisense; GGAGACCAAGAGAACACCACTGCAA
>probe:Drosophila_2:1637495_at:290:265; Interrogation_Position=519; Antisense; CAGTGACATTGCTTTGATTCGTTTC
>probe:Drosophila_2:1637495_at:149:381; Interrogation_Position=547; Antisense; GAACCAGTTCGTCTTGGCATCGATA
>probe:Drosophila_2:1637495_at:644:681; Interrogation_Position=607; Antisense; TATGCGGGTCAAACTGCCGTGGTCA
>probe:Drosophila_2:1637495_at:462:605; Interrogation_Position=651; Antisense; TGAGGGCGGACCAATTTCTGATACC
>probe:Drosophila_2:1637495_at:32:363; Interrogation_Position=719; Antisense; GCAATAGCAACTACGGCGAGTCCAA
>probe:Drosophila_2:1637495_at:301:673; Interrogation_Position=747; Antisense; TACCGACAACATGATCTGTGCCGGC
>probe:Drosophila_2:1637495_at:95:107; Interrogation_Position=807; Antisense; AGACAGCGGTGGACCCATGCATGTA
>probe:Drosophila_2:1637495_at:667:269; Interrogation_Position=822; Antisense; CATGCATGTACTGGGTTCCGGCGAC
>probe:Drosophila_2:1637495_at:678:325; Interrogation_Position=842; Antisense; GCGACGCTTACCAGCTGGCAGGAAT
>probe:Drosophila_2:1637495_at:420:371; Interrogation_Position=880; Antisense; GAAGGATGTGCCAAGCCGAATGCCC
>probe:Drosophila_2:1637495_at:562:233; Interrogation_Position=898; Antisense; AATGCCCCGGGCGTTTATACACGAG
>probe:Drosophila_2:1637495_at:76:157; Interrogation_Position=916; Antisense; ACACGAGTGGGCAGCTTCAATGATT
>probe:Drosophila_2:1637495_at:578:7; Interrogation_Position=943; Antisense; ATTGCGGAGAACACCAGGGATGCCT

Paste this into a BLAST search page for me
GGAGACCAAGAGAACACCACTGCAACAGTGACATTGCTTTGATTCGTTTCGAACCAGTTCGTCTTGGCATCGATATATGCGGGTCAAACTGCCGTGGTCATGAGGGCGGACCAATTTCTGATACCGCAATAGCAACTACGGCGAGTCCAATACCGACAACATGATCTGTGCCGGCAGACAGCGGTGGACCCATGCATGTACATGCATGTACTGGGTTCCGGCGACGCGACGCTTACCAGCTGGCAGGAATGAAGGATGTGCCAAGCCGAATGCCCAATGCCCCGGGCGTTTATACACGAGACACGAGTGGGCAGCTTCAATGATTATTGCGGAGAACACCAGGGATGCCT

Full Affymetrix probeset data:

Annotations for 1637495_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720