FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637497_at:

>probe:Drosophila_2:1637497_at:28:145; Interrogation_Position=2185; Antisense; ACTGCGAGTGTGTCTGCCCACAGTC
>probe:Drosophila_2:1637497_at:523:405; Interrogation_Position=2215; Antisense; GACGGACCCTCTAGCAAAGCCTTTT
>probe:Drosophila_2:1637497_at:390:161; Interrogation_Position=2230; Antisense; AAAGCCTTTTCGAGCTCGGGACCAG
>probe:Drosophila_2:1637497_at:415:127; Interrogation_Position=2253; Antisense; AGCCACAGATCGCTATACAGCAATG
>probe:Drosophila_2:1637497_at:461:69; Interrogation_Position=2282; Antisense; AGGCATTCCGATCCCAGTATAACAA
>probe:Drosophila_2:1637497_at:61:31; Interrogation_Position=2300; Antisense; ATAACAATCAGTTCCGTGCGTCCAG
>probe:Drosophila_2:1637497_at:552:325; Interrogation_Position=2324; Antisense; GCGATCGCACTTGGGAGAAAACTCT
>probe:Drosophila_2:1637497_at:590:645; Interrogation_Position=2389; Antisense; TCATCATCAACACAGGGTGCTTCCG
>probe:Drosophila_2:1637497_at:74:383; Interrogation_Position=2477; Antisense; GAACGACGAGCCCAATAAACTGATG
>probe:Drosophila_2:1637497_at:642:335; Interrogation_Position=2501; Antisense; GCTGCTATTTGGTTTATTTCTCTTC
>probe:Drosophila_2:1637497_at:327:515; Interrogation_Position=2538; Antisense; GTGTATTTGCTTTTGTTCCATCGTT
>probe:Drosophila_2:1637497_at:645:29; Interrogation_Position=2650; Antisense; ATACTCGTATGTACAACTCTCTTCC
>probe:Drosophila_2:1637497_at:726:93; Interrogation_Position=2684; Antisense; AGTTCCAGCGAACGATCCCACAGAT
>probe:Drosophila_2:1637497_at:285:365; Interrogation_Position=2760; Antisense; GAATAAAATCACATTTGCGCATCCC

Paste this into a BLAST search page for me
ACTGCGAGTGTGTCTGCCCACAGTCGACGGACCCTCTAGCAAAGCCTTTTAAAGCCTTTTCGAGCTCGGGACCAGAGCCACAGATCGCTATACAGCAATGAGGCATTCCGATCCCAGTATAACAAATAACAATCAGTTCCGTGCGTCCAGGCGATCGCACTTGGGAGAAAACTCTTCATCATCAACACAGGGTGCTTCCGGAACGACGAGCCCAATAAACTGATGGCTGCTATTTGGTTTATTTCTCTTCGTGTATTTGCTTTTGTTCCATCGTTATACTCGTATGTACAACTCTCTTCCAGTTCCAGCGAACGATCCCACAGATGAATAAAATCACATTTGCGCATCCC

Full Affymetrix probeset data:

Annotations for 1637497_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720