Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637501_a_at:

>probe:Drosophila_2:1637501_a_at:23:219; Interrogation_Position=113; Antisense; AAGTAAACGATGCAGCCCCGAAATA
>probe:Drosophila_2:1637501_a_at:250:515; Interrogation_Position=148; Antisense; GTGTTTGATCTATATAACGCCCTGT
>probe:Drosophila_2:1637501_a_at:476:199; Interrogation_Position=163; Antisense; AACGCCCTGTGTGCAGCAATTGTGT
>probe:Drosophila_2:1637501_a_at:543:513; Interrogation_Position=184; Antisense; GTGTTTCTATGGCACTAGGCGACAT
>probe:Drosophila_2:1637501_a_at:431:151; Interrogation_Position=205; Antisense; ACATTTACTGGCCATGCAGTCCTTG
>probe:Drosophila_2:1637501_a_at:611:591; Interrogation_Position=224; Antisense; TCCTTGTCCGCCCAAAGGAATCGGA
>probe:Drosophila_2:1637501_a_at:537:563; Interrogation_Position=246; Antisense; GGAAGTCTGATGTCTCCGAAAAGAA
>probe:Drosophila_2:1637501_a_at:686:703; Interrogation_Position=336; Antisense; TTAGTCTGCTCCGTCGAAATTCGAC
>probe:Drosophila_2:1637501_a_at:184:395; Interrogation_Position=351; Antisense; GAAATTCGACAGATTCCGCGAGGAA
>probe:Drosophila_2:1637501_a_at:223:387; Interrogation_Position=382; Antisense; GAAAACCGCATTCATTCGATACGAA
>probe:Drosophila_2:1637501_a_at:335:721; Interrogation_Position=422; Antisense; TTGGCCAAAAGTGCCCGAAAGCTAT
>probe:Drosophila_2:1637501_a_at:305:167; Interrogation_Position=451; Antisense; AAATGCCCGGCTAAGGAGCTTGCCT
>probe:Drosophila_2:1637501_a_at:408:417; Interrogation_Position=466; Antisense; GAGCTTGCCTTTGAGGAAGCCCATG
>probe:Drosophila_2:1637501_a_at:572:511; Interrogation_Position=507; Antisense; GTGACTCTGATGCAAGACCCCTAAG

Paste this into a BLAST search page for me
AAGTAAACGATGCAGCCCCGAAATAGTGTTTGATCTATATAACGCCCTGTAACGCCCTGTGTGCAGCAATTGTGTGTGTTTCTATGGCACTAGGCGACATACATTTACTGGCCATGCAGTCCTTGTCCTTGTCCGCCCAAAGGAATCGGAGGAAGTCTGATGTCTCCGAAAAGAATTAGTCTGCTCCGTCGAAATTCGACGAAATTCGACAGATTCCGCGAGGAAGAAAACCGCATTCATTCGATACGAATTGGCCAAAAGTGCCCGAAAGCTATAAATGCCCGGCTAAGGAGCTTGCCTGAGCTTGCCTTTGAGGAAGCCCATGGTGACTCTGATGCAAGACCCCTAAG

Full Affymetrix probeset data:

Annotations for 1637501_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime