FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637502_at:

>probe:Drosophila_2:1637502_at:229:219; Interrogation_Position=1060; Antisense; AAGTGCAAGTTCTGCCTGAGACCTT
>probe:Drosophila_2:1637502_at:577:449; Interrogation_Position=1090; Antisense; GATCCCAGCAATCTCAACAAGCATG
>probe:Drosophila_2:1637502_at:398:159; Interrogation_Position=1106; Antisense; ACAAGCATGTGAGGCTGCATCTGCA
>probe:Drosophila_2:1637502_at:607:39; Interrogation_Position=1124; Antisense; ATCTGCAGACGCATCCGAGTAGTTC
>probe:Drosophila_2:1637502_at:502:85; Interrogation_Position=1232; Antisense; AGTGCCACGTGTGCCATAAATCCTT
>probe:Drosophila_2:1637502_at:473:29; Interrogation_Position=1247; Antisense; ATAAATCCTTTCCACGACGCAGGGA
>probe:Drosophila_2:1637502_at:355:141; Interrogation_Position=1378; Antisense; ACGGTGACCACATCTACTTCGAAAT
>probe:Drosophila_2:1637502_at:507:255; Interrogation_Position=817; Antisense; CAGAGTTTGCCCATGGTACCCGTAA
>probe:Drosophila_2:1637502_at:456:617; Interrogation_Position=891; Antisense; TGCACCGTTGTCGACGAATCCAATG
>probe:Drosophila_2:1637502_at:215:369; Interrogation_Position=906; Antisense; GAATCCAATGAATGCAGCTGCCCAG
>probe:Drosophila_2:1637502_at:657:97; Interrogation_Position=929; Antisense; AGATCGAGGCCATAGTCAGCAATAT
>probe:Drosophila_2:1637502_at:711:241; Interrogation_Position=949; Antisense; AATATGGGTGCCTCCAAGCAGGGTC
>probe:Drosophila_2:1637502_at:712:207; Interrogation_Position=964; Antisense; AAGCAGGGTCATCTGTGCATCTACT
>probe:Drosophila_2:1637502_at:94:597; Interrogation_Position=998; Antisense; TGTACTCCCGGAAATATGGCCTGAA

Paste this into a BLAST search page for me
AAGTGCAAGTTCTGCCTGAGACCTTGATCCCAGCAATCTCAACAAGCATGACAAGCATGTGAGGCTGCATCTGCAATCTGCAGACGCATCCGAGTAGTTCAGTGCCACGTGTGCCATAAATCCTTATAAATCCTTTCCACGACGCAGGGAACGGTGACCACATCTACTTCGAAATCAGAGTTTGCCCATGGTACCCGTAATGCACCGTTGTCGACGAATCCAATGGAATCCAATGAATGCAGCTGCCCAGAGATCGAGGCCATAGTCAGCAATATAATATGGGTGCCTCCAAGCAGGGTCAAGCAGGGTCATCTGTGCATCTACTTGTACTCCCGGAAATATGGCCTGAA

Full Affymetrix probeset data:

Annotations for 1637502_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720