FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637503_at:

>probe:Drosophila_2:1637503_at:311:201; Interrogation_Position=2591; Antisense; AACCAACTCTACAGGCACTGGAGGC
>probe:Drosophila_2:1637503_at:478:617; Interrogation_Position=2684; Antisense; TGCAGTGGCGGCGAGCTTAAATAAT
>probe:Drosophila_2:1637503_at:157:189; Interrogation_Position=2742; Antisense; AACAGCAGCCATTCGCCCGGTGAGA
>probe:Drosophila_2:1637503_at:437:445; Interrogation_Position=2765; Antisense; GATGACGACACCAGGACAGCTCCAG
>probe:Drosophila_2:1637503_at:37:119; Interrogation_Position=2788; Antisense; AGCTGCCCACGGAGTATTTGAGCGA
>probe:Drosophila_2:1637503_at:476:713; Interrogation_Position=2815; Antisense; TTCAGGAGCTGCACCACAAGATCAT
>probe:Drosophila_2:1637503_at:214:161; Interrogation_Position=2830; Antisense; ACAAGATCATGACCCTGCAGGACAA
>probe:Drosophila_2:1637503_at:194:157; Interrogation_Position=2867; Antisense; ACACGTCGTGGAGATGATCGCGGCC
>probe:Drosophila_2:1637503_at:92:579; Interrogation_Position=2888; Antisense; GGCCACCGGATGCTACGAGATCACG
>probe:Drosophila_2:1637503_at:262:451; Interrogation_Position=2906; Antisense; GATCACGCACAAGACGTTCGACTTC
>probe:Drosophila_2:1637503_at:523:471; Interrogation_Position=2921; Antisense; GTTCGACTTCGACCTGTGCAAGCTG
>probe:Drosophila_2:1637503_at:122:573; Interrogation_Position=3026; Antisense; GGCTCTCTACAGCTAGACGATGCAC
>probe:Drosophila_2:1637503_at:28:359; Interrogation_Position=3115; Antisense; GCAAATGAACTTGGCTCGCACACAG
>probe:Drosophila_2:1637503_at:97:95; Interrogation_Position=3157; Antisense; AGATCGTAAGTTACGTTGGCCCGAG

Paste this into a BLAST search page for me
AACCAACTCTACAGGCACTGGAGGCTGCAGTGGCGGCGAGCTTAAATAATAACAGCAGCCATTCGCCCGGTGAGAGATGACGACACCAGGACAGCTCCAGAGCTGCCCACGGAGTATTTGAGCGATTCAGGAGCTGCACCACAAGATCATACAAGATCATGACCCTGCAGGACAAACACGTCGTGGAGATGATCGCGGCCGGCCACCGGATGCTACGAGATCACGGATCACGCACAAGACGTTCGACTTCGTTCGACTTCGACCTGTGCAAGCTGGGCTCTCTACAGCTAGACGATGCACGCAAATGAACTTGGCTCGCACACAGAGATCGTAAGTTACGTTGGCCCGAG

Full Affymetrix probeset data:

Annotations for 1637503_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720