Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637504_at:

>probe:Drosophila_2:1637504_at:553:111; Interrogation_Position=2266; Antisense; AGCACCCAGCCAAATTTATACGCGA
>probe:Drosophila_2:1637504_at:14:21; Interrogation_Position=2352; Antisense; ATTTGTCAAGATGTTTCGCTCGGCA
>probe:Drosophila_2:1637504_at:269:719; Interrogation_Position=2366; Antisense; TTCGCTCGGCAGTTAATGCTGCACA
>probe:Drosophila_2:1637504_at:240:93; Interrogation_Position=2399; Antisense; AGATTTTATACCTTTCTTGCATTAA
>probe:Drosophila_2:1637504_at:41:15; Interrogation_Position=2460; Antisense; ATTTTCCCAAATTTACCAGTTCATG
>probe:Drosophila_2:1637504_at:694:329; Interrogation_Position=2557; Antisense; GCGTGGTCTGAAAGCGATGCACTTA
>probe:Drosophila_2:1637504_at:297:259; Interrogation_Position=2591; Antisense; CACTGCACCCGTTCTATAGTAGTTG
>probe:Drosophila_2:1637504_at:657:725; Interrogation_Position=2616; Antisense; TTGTTACTGTTGCTGTGAGCTGCTC
>probe:Drosophila_2:1637504_at:389:517; Interrogation_Position=2641; Antisense; GTGGTTGTTGCTCGTGTTTCCTAAC
>probe:Drosophila_2:1637504_at:550:91; Interrogation_Position=2672; Antisense; AGTTTGAAACTGCAGCTCACCTTCG
>probe:Drosophila_2:1637504_at:646:335; Interrogation_Position=2706; Antisense; GCTCTCGTCTGTGTTCTGACATGAT
>probe:Drosophila_2:1637504_at:256:401; Interrogation_Position=2723; Antisense; GACATGATTCCCTGTGGTATGGCAT
>probe:Drosophila_2:1637504_at:541:539; Interrogation_Position=2738; Antisense; GGTATGGCATACACCCAGAACTCAC
>probe:Drosophila_2:1637504_at:616:31; Interrogation_Position=2803; Antisense; ATAACTCTGCTCTTTTCGGCTTGAA

Paste this into a BLAST search page for me
AGCACCCAGCCAAATTTATACGCGAATTTGTCAAGATGTTTCGCTCGGCATTCGCTCGGCAGTTAATGCTGCACAAGATTTTATACCTTTCTTGCATTAAATTTTCCCAAATTTACCAGTTCATGGCGTGGTCTGAAAGCGATGCACTTACACTGCACCCGTTCTATAGTAGTTGTTGTTACTGTTGCTGTGAGCTGCTCGTGGTTGTTGCTCGTGTTTCCTAACAGTTTGAAACTGCAGCTCACCTTCGGCTCTCGTCTGTGTTCTGACATGATGACATGATTCCCTGTGGTATGGCATGGTATGGCATACACCCAGAACTCACATAACTCTGCTCTTTTCGGCTTGAA

Full Affymetrix probeset data:

Annotations for 1637504_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime