FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637506_at:

>probe:Drosophila_2:1637506_at:386:377; Interrogation_Position=3524; Antisense; GAAGCAACTCAACTAATGCCAACTC
>probe:Drosophila_2:1637506_at:713:111; Interrogation_Position=3619; Antisense; AGCAAAAGCGCTGAGCTTTCCTTCA
>probe:Drosophila_2:1637506_at:358:591; Interrogation_Position=3630; Antisense; TGAGCTTTCCTTCACGCCGGAAAAC
>probe:Drosophila_2:1637506_at:148:677; Interrogation_Position=3672; Antisense; TAGAAAAATCCCCAGACCTAAGCAA
>probe:Drosophila_2:1637506_at:681:161; Interrogation_Position=3702; Antisense; ACAATTTCACACGATTTAAGGCAGA
>probe:Drosophila_2:1637506_at:105:569; Interrogation_Position=3721; Antisense; GGCAGAACATAATTACACATCCGCA
>probe:Drosophila_2:1637506_at:183:651; Interrogation_Position=3778; Antisense; TCAACGATGCAAGTGACGTCTGCTT
>probe:Drosophila_2:1637506_at:553:85; Interrogation_Position=3789; Antisense; AGTGACGTCTGCTTGTGATATTTAC
>probe:Drosophila_2:1637506_at:665:463; Interrogation_Position=3865; Antisense; GATTCCATATCTCTTTCGTATCTGT
>probe:Drosophila_2:1637506_at:4:475; Interrogation_Position=3899; Antisense; GTTAATCTCTCGATGTGCGTAGACC
>probe:Drosophila_2:1637506_at:706:319; Interrogation_Position=3915; Antisense; GCGTAGACCACGTAATGTATTTATT
>probe:Drosophila_2:1637506_at:44:687; Interrogation_Position=3991; Antisense; TATTACTCTCTCGTTTTCCTTCTTA
>probe:Drosophila_2:1637506_at:437:579; Interrogation_Position=4042; Antisense; GGCCATTTACATGTAGCAAGCGCTT
>probe:Drosophila_2:1637506_at:630:123; Interrogation_Position=4060; Antisense; AGCGCTTAGTTTAGATTTGTGTGTA

Paste this into a BLAST search page for me
GAAGCAACTCAACTAATGCCAACTCAGCAAAAGCGCTGAGCTTTCCTTCATGAGCTTTCCTTCACGCCGGAAAACTAGAAAAATCCCCAGACCTAAGCAAACAATTTCACACGATTTAAGGCAGAGGCAGAACATAATTACACATCCGCATCAACGATGCAAGTGACGTCTGCTTAGTGACGTCTGCTTGTGATATTTACGATTCCATATCTCTTTCGTATCTGTGTTAATCTCTCGATGTGCGTAGACCGCGTAGACCACGTAATGTATTTATTTATTACTCTCTCGTTTTCCTTCTTAGGCCATTTACATGTAGCAAGCGCTTAGCGCTTAGTTTAGATTTGTGTGTA

Full Affymetrix probeset data:

Annotations for 1637506_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720