FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637507_at:

>probe:Drosophila_2:1637507_at:375:513; Interrogation_Position=113; Antisense; GTGTACTTGACTTTGCGAAACCGAG
>probe:Drosophila_2:1637507_at:513:83; Interrogation_Position=136; Antisense; AGTGGTGATATTTCATACTCCAAAG
>probe:Drosophila_2:1637507_at:461:21; Interrogation_Position=169; Antisense; ATATACATTGAAGACCGCGCGGAAC
>probe:Drosophila_2:1637507_at:68:413; Interrogation_Position=181; Antisense; GACCGCGCGGAACCAAACGAATGAA
>probe:Drosophila_2:1637507_at:562:667; Interrogation_Position=208; Antisense; TACTGGAAATCTTGACGGTAGCGAT
>probe:Drosophila_2:1637507_at:312:459; Interrogation_Position=239; Antisense; GATATCAGCGGAGACTCAATCGAGT
>probe:Drosophila_2:1637507_at:49:431; Interrogation_Position=260; Antisense; GAGTATTCAGTTCCAGTCCAATTGT
>probe:Drosophila_2:1637507_at:395:599; Interrogation_Position=282; Antisense; TGTTTGGAAATCTTGACGGTAGCGA
>probe:Drosophila_2:1637507_at:221:365; Interrogation_Position=377; Antisense; GAATCGTCGGATCAACATTGTTTTC
>probe:Drosophila_2:1637507_at:259:529; Interrogation_Position=424; Antisense; GGGAGCTACCTGAAAGACTCTATTG
>probe:Drosophila_2:1637507_at:427:177; Interrogation_Position=460; Antisense; AAACGATTGAGACCACTTCGCTGCA
>probe:Drosophila_2:1637507_at:711:149; Interrogation_Position=474; Antisense; ACTTCGCTGCATCTCTTGATTAACA
>probe:Drosophila_2:1637507_at:71:203; Interrogation_Position=499; Antisense; AACCGTGGTGCATATGTGCTTTTGA
>probe:Drosophila_2:1637507_at:351:19; Interrogation_Position=569; Antisense; ATTTGCATTAGTTCGCTAACCTGAA

Paste this into a BLAST search page for me
GTGTACTTGACTTTGCGAAACCGAGAGTGGTGATATTTCATACTCCAAAGATATACATTGAAGACCGCGCGGAACGACCGCGCGGAACCAAACGAATGAATACTGGAAATCTTGACGGTAGCGATGATATCAGCGGAGACTCAATCGAGTGAGTATTCAGTTCCAGTCCAATTGTTGTTTGGAAATCTTGACGGTAGCGAGAATCGTCGGATCAACATTGTTTTCGGGAGCTACCTGAAAGACTCTATTGAAACGATTGAGACCACTTCGCTGCAACTTCGCTGCATCTCTTGATTAACAAACCGTGGTGCATATGTGCTTTTGAATTTGCATTAGTTCGCTAACCTGAA

Full Affymetrix probeset data:

Annotations for 1637507_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720