FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637508_at:

>probe:Drosophila_2:1637508_at:16:507; Interrogation_Position=1018; Antisense; GTGCCGCACACAGGGTTTATACATA
>probe:Drosophila_2:1637508_at:612:151; Interrogation_Position=1038; Antisense; ACATACATGCTGCTTGCTTAGGCGC
>probe:Drosophila_2:1637508_at:396:69; Interrogation_Position=1057; Antisense; AGGCGCCAGGCTTATTTACTATAGA
>probe:Drosophila_2:1637508_at:635:435; Interrogation_Position=1131; Antisense; GAGGATTTGCCTCGAATATGCCGCT
>probe:Drosophila_2:1637508_at:207:243; Interrogation_Position=1145; Antisense; AATATGCCGCTACTTACGTTGCCTT
>probe:Drosophila_2:1637508_at:244:715; Interrogation_Position=1174; Antisense; TTCGGTGGCGCCCATTTAATTGTAC
>probe:Drosophila_2:1637508_at:419:651; Interrogation_Position=1190; Antisense; TAATTGTACCCTTTAGAGCCCGTAT
>probe:Drosophila_2:1637508_at:500:247; Interrogation_Position=678; Antisense; AATTGTGTGCTGCATCGTGACCGTG
>probe:Drosophila_2:1637508_at:329:333; Interrogation_Position=720; Antisense; GCTGGCTAGCTTGCTGCATGTGATA
>probe:Drosophila_2:1637508_at:667:305; Interrogation_Position=804; Antisense; CCTGCAGTGGCTTATCTACGGTATA
>probe:Drosophila_2:1637508_at:371:557; Interrogation_Position=837; Antisense; GGACTCATTTATCCAGATTCCCAAC
>probe:Drosophila_2:1637508_at:67:193; Interrogation_Position=859; Antisense; AACTTTCTGGGCTGCATACTGTCGC
>probe:Drosophila_2:1637508_at:4:121; Interrogation_Position=944; Antisense; AGCTGGTCGAACAGGCAGTGCCGTT
>probe:Drosophila_2:1637508_at:557:117; Interrogation_Position=975; Antisense; AGCTAATCGGACCAAGCCACGCATT

Paste this into a BLAST search page for me
GTGCCGCACACAGGGTTTATACATAACATACATGCTGCTTGCTTAGGCGCAGGCGCCAGGCTTATTTACTATAGAGAGGATTTGCCTCGAATATGCCGCTAATATGCCGCTACTTACGTTGCCTTTTCGGTGGCGCCCATTTAATTGTACTAATTGTACCCTTTAGAGCCCGTATAATTGTGTGCTGCATCGTGACCGTGGCTGGCTAGCTTGCTGCATGTGATACCTGCAGTGGCTTATCTACGGTATAGGACTCATTTATCCAGATTCCCAACAACTTTCTGGGCTGCATACTGTCGCAGCTGGTCGAACAGGCAGTGCCGTTAGCTAATCGGACCAAGCCACGCATT

Full Affymetrix probeset data:

Annotations for 1637508_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720