Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637511_at:

>probe:Drosophila_2:1637511_at:446:647; Interrogation_Position=136; Antisense; TCATCCTGGCCATTATGGTGGCCAA
>probe:Drosophila_2:1637511_at:223:133; Interrogation_Position=174; Antisense; ACCCTGGACGAGATCGTCGATGAAC
>probe:Drosophila_2:1637511_at:576:501; Interrogation_Position=189; Antisense; GTCGATGAACTGACGGCGGTGATCA
>probe:Drosophila_2:1637511_at:592:605; Interrogation_Position=208; Antisense; TGATCAATTCGCAAACCGAGCTCGC
>probe:Drosophila_2:1637511_at:273:295; Interrogation_Position=224; Antisense; CGAGCTCGCCATTGCGCATGAAAAT
>probe:Drosophila_2:1637511_at:314:149; Interrogation_Position=263; Antisense; ACATAGCCACAAGTCGTATAAGCCG
>probe:Drosophila_2:1637511_at:504:689; Interrogation_Position=27; Antisense; TATTCCAAATTGAGCTCTGGCGTTT
>probe:Drosophila_2:1637511_at:96:303; Interrogation_Position=285; Antisense; CCGAGACGAAGGCACTAAGGATCTT
>probe:Drosophila_2:1637511_at:490:545; Interrogation_Position=303; Antisense; GGATCTTAACATGCGTTATGTGCCA
>probe:Drosophila_2:1637511_at:497:417; Interrogation_Position=38; Antisense; GAGCTCTGGCGTTTTGTATTTTGTT
>probe:Drosophila_2:1637511_at:68:31; Interrogation_Position=392; Antisense; ATAAACTGATCGTGTCGGCGGCGAC
>probe:Drosophila_2:1637511_at:505:325; Interrogation_Position=412; Antisense; GCGACACTTATTTCCGTCCGTGAGT
>probe:Drosophila_2:1637511_at:662:629; Interrogation_Position=424; Antisense; TCCGTCCGTGAGTGAAATAGTTATT
>probe:Drosophila_2:1637511_at:352:377; Interrogation_Position=94; Antisense; GAAGCACAATGGATGGCTGCCACAA

Paste this into a BLAST search page for me
TCATCCTGGCCATTATGGTGGCCAAACCCTGGACGAGATCGTCGATGAACGTCGATGAACTGACGGCGGTGATCATGATCAATTCGCAAACCGAGCTCGCCGAGCTCGCCATTGCGCATGAAAATACATAGCCACAAGTCGTATAAGCCGTATTCCAAATTGAGCTCTGGCGTTTCCGAGACGAAGGCACTAAGGATCTTGGATCTTAACATGCGTTATGTGCCAGAGCTCTGGCGTTTTGTATTTTGTTATAAACTGATCGTGTCGGCGGCGACGCGACACTTATTTCCGTCCGTGAGTTCCGTCCGTGAGTGAAATAGTTATTGAAGCACAATGGATGGCTGCCACAA

Full Affymetrix probeset data:

Annotations for 1637511_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime