FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637513_at:

>probe:Drosophila_2:1637513_at:186:269; Interrogation_Position=1106; Antisense; CAGGCCCTTTACAGTGGATGCAGAA
>probe:Drosophila_2:1637513_at:83:719; Interrogation_Position=1141; Antisense; TTCGCTTGCGTCTAAAGTGCTCTAG
>probe:Drosophila_2:1637513_at:266:17; Interrogation_Position=1166; Antisense; ATTTATCTCCTTGATGGGCTTGGTC
>probe:Drosophila_2:1637513_at:552:431; Interrogation_Position=1316; Antisense; GAGTCACGTTGTCCAGAGCCAGAAT
>probe:Drosophila_2:1637513_at:613:89; Interrogation_Position=1345; Antisense; AGTACAACTGCAACCTGCATCTTGG
>probe:Drosophila_2:1637513_at:345:619; Interrogation_Position=1360; Antisense; TGCATCTTGGCTGGCGACGCGAAGA
>probe:Drosophila_2:1637513_at:552:213; Interrogation_Position=1381; Antisense; AAGAGGCCTGTGTGCTGAATCCGGA
>probe:Drosophila_2:1637513_at:528:609; Interrogation_Position=1408; Antisense; TGACCTATGAGCTGCAGATCCGCTG
>probe:Drosophila_2:1637513_at:493:155; Interrogation_Position=1435; Antisense; ACAGCAGTGCTTACGGCGCCGAGTA
>probe:Drosophila_2:1637513_at:188:315; Interrogation_Position=1480; Antisense; GCCAGGCGGACGGAATTCGGTTCAC
>probe:Drosophila_2:1637513_at:76:717; Interrogation_Position=1495; Antisense; TTCGGTTCACTGACGAGGACAGCTT
>probe:Drosophila_2:1637513_at:647:153; Interrogation_Position=1513; Antisense; ACAGCTTCAGCGGAAGTCTCGTCAA
>probe:Drosophila_2:1637513_at:457:637; Interrogation_Position=1531; Antisense; TCGTCAAGGGACTGCGCTATGCCAA
>probe:Drosophila_2:1637513_at:353:229; Interrogation_Position=1632; Antisense; AATGTACGCTGCCTCAGAGTTCAAT

Paste this into a BLAST search page for me
CAGGCCCTTTACAGTGGATGCAGAATTCGCTTGCGTCTAAAGTGCTCTAGATTTATCTCCTTGATGGGCTTGGTCGAGTCACGTTGTCCAGAGCCAGAATAGTACAACTGCAACCTGCATCTTGGTGCATCTTGGCTGGCGACGCGAAGAAAGAGGCCTGTGTGCTGAATCCGGATGACCTATGAGCTGCAGATCCGCTGACAGCAGTGCTTACGGCGCCGAGTAGCCAGGCGGACGGAATTCGGTTCACTTCGGTTCACTGACGAGGACAGCTTACAGCTTCAGCGGAAGTCTCGTCAATCGTCAAGGGACTGCGCTATGCCAAAATGTACGCTGCCTCAGAGTTCAAT

Full Affymetrix probeset data:

Annotations for 1637513_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720