FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637514_at:

>probe:Drosophila_2:1637514_at:104:617; Interrogation_Position=1196; Antisense; TGCAGCGTCTGATTCGTACCAAGTG
>probe:Drosophila_2:1637514_at:373:649; Interrogation_Position=1242; Antisense; TCACGTGCAGCCATCGATGTTGAGT
>probe:Drosophila_2:1637514_at:479:429; Interrogation_Position=1263; Antisense; GAGTTATCTTTTTAGTACCACACAG
>probe:Drosophila_2:1637514_at:452:57; Interrogation_Position=712; Antisense; ATGATTGGTCTTCTGCTCTGGGACA
>probe:Drosophila_2:1637514_at:316:593; Interrogation_Position=730; Antisense; TGGGACATCGAGTCAGCTAGCGCTG
>probe:Drosophila_2:1637514_at:88:675; Interrogation_Position=747; Antisense; TAGCGCTGCAGTTAATCAGTCCCGT
>probe:Drosophila_2:1637514_at:285:729; Interrogation_Position=810; Antisense; TTGGATAACCAGCTGCACGGGTCAC
>probe:Drosophila_2:1637514_at:264:141; Interrogation_Position=826; Antisense; ACGGGTCACTTTGGCGTGATCTTTA
>probe:Drosophila_2:1637514_at:293:161; Interrogation_Position=851; Antisense; ACAAGAATCCGGATCTGTTGCGCAA
>probe:Drosophila_2:1637514_at:315:331; Interrogation_Position=883; Antisense; GCGGAGTCGCGTTTCGATGTTAACT
>probe:Drosophila_2:1637514_at:491:443; Interrogation_Position=898; Antisense; GATGTTAACTACTACAGCTGCTCCG
>probe:Drosophila_2:1637514_at:393:119; Interrogation_Position=913; Antisense; AGCTGCTCCGGTCATCAGATACTGA
>probe:Drosophila_2:1637514_at:369:607; Interrogation_Position=935; Antisense; TGATGACCATCGACAATCGCACGTA
>probe:Drosophila_2:1637514_at:333:239; Interrogation_Position=996; Antisense; AATCACGCCGGAGAGTACCTCGATG

Paste this into a BLAST search page for me
TGCAGCGTCTGATTCGTACCAAGTGTCACGTGCAGCCATCGATGTTGAGTGAGTTATCTTTTTAGTACCACACAGATGATTGGTCTTCTGCTCTGGGACATGGGACATCGAGTCAGCTAGCGCTGTAGCGCTGCAGTTAATCAGTCCCGTTTGGATAACCAGCTGCACGGGTCACACGGGTCACTTTGGCGTGATCTTTAACAAGAATCCGGATCTGTTGCGCAAGCGGAGTCGCGTTTCGATGTTAACTGATGTTAACTACTACAGCTGCTCCGAGCTGCTCCGGTCATCAGATACTGATGATGACCATCGACAATCGCACGTAAATCACGCCGGAGAGTACCTCGATG

Full Affymetrix probeset data:

Annotations for 1637514_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720