FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637516_at:

>probe:Drosophila_2:1637516_at:226:459; Interrogation_Position=118; Antisense; GATATAATGACTTCGTTCCTGGCCA
>probe:Drosophila_2:1637516_at:128:141; Interrogation_Position=154; Antisense; ACGGGCTACATCATAGTGGTCATCG
>probe:Drosophila_2:1637516_at:167:725; Interrogation_Position=185; Antisense; TTGCAGGCGTTCTGATGCGGGCACC
>probe:Drosophila_2:1637516_at:135:133; Interrogation_Position=207; Antisense; ACCCATTCACAAGCGCATCGATATA
>probe:Drosophila_2:1637516_at:656:41; Interrogation_Position=223; Antisense; ATCGATATATTCTTCAGCGTCCTGG
>probe:Drosophila_2:1637516_at:163:593; Interrogation_Position=245; Antisense; TGGGCTGCACCTTGTTCGTGGCCAG
>probe:Drosophila_2:1637516_at:316:581; Interrogation_Position=263; Antisense; TGGCCAGCGGTGTGTTCATCATTGA
>probe:Drosophila_2:1637516_at:314:37; Interrogation_Position=280; Antisense; ATCATTGAGGCCTGGGAGTTCTCCT
>probe:Drosophila_2:1637516_at:365:169; Interrogation_Position=31; Antisense; AAAGGCCGCCTCAATGTGGTCAAGT
>probe:Drosophila_2:1637516_at:530:11; Interrogation_Position=369; Antisense; ATTCGGATTCGATGCGGTGTTCACA
>probe:Drosophila_2:1637516_at:671:329; Interrogation_Position=382; Antisense; GCGGTGTTCACATTTCGCGACAAGT
>probe:Drosophila_2:1637516_at:167:711; Interrogation_Position=56; Antisense; TTCTCGAACTGGGTTTTGCGGTAGC
>probe:Drosophila_2:1637516_at:678:721; Interrogation_Position=71; Antisense; TTGCGGTAGCGTGTCTGGTGCTCCA
>probe:Drosophila_2:1637516_at:680:591; Interrogation_Position=86; Antisense; TGGTGCTCCACTTCTACAGCTTCAA

Paste this into a BLAST search page for me
GATATAATGACTTCGTTCCTGGCCAACGGGCTACATCATAGTGGTCATCGTTGCAGGCGTTCTGATGCGGGCACCACCCATTCACAAGCGCATCGATATAATCGATATATTCTTCAGCGTCCTGGTGGGCTGCACCTTGTTCGTGGCCAGTGGCCAGCGGTGTGTTCATCATTGAATCATTGAGGCCTGGGAGTTCTCCTAAAGGCCGCCTCAATGTGGTCAAGTATTCGGATTCGATGCGGTGTTCACAGCGGTGTTCACATTTCGCGACAAGTTTCTCGAACTGGGTTTTGCGGTAGCTTGCGGTAGCGTGTCTGGTGCTCCATGGTGCTCCACTTCTACAGCTTCAA

Full Affymetrix probeset data:

Annotations for 1637516_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720