FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637518_at:

>probe:Drosophila_2:1637518_at:26:725; Interrogation_Position=1225; Antisense; TTGGGCGTGAACTACATGCAGATAC
>probe:Drosophila_2:1637518_at:2:363; Interrogation_Position=1254; Antisense; GAATTGTCCGTACCGCGTGAATGTT
>probe:Drosophila_2:1637518_at:615:229; Interrogation_Position=1273; Antisense; AATGTTCGCAACTTCCAGAGGGATG
>probe:Drosophila_2:1637518_at:75:349; Interrogation_Position=1294; Antisense; GATGGTGCTATGACAGTGACTGACA
>probe:Drosophila_2:1637518_at:648:121; Interrogation_Position=1435; Antisense; AGCGGTGACACCGAGGACAATTTCA
>probe:Drosophila_2:1637518_at:429:559; Interrogation_Position=1449; Antisense; GGACAATTTCAGTCAGGTCACCGAC
>probe:Drosophila_2:1637518_at:87:545; Interrogation_Position=1478; Antisense; GGACCTACACCCTGGATAACTGCGG
>probe:Drosophila_2:1637518_at:160:207; Interrogation_Position=1507; Antisense; AAGCGGCTAGTTCGCAACTTGTCCG
>probe:Drosophila_2:1637518_at:499:189; Interrogation_Position=1522; Antisense; AACTTGTCCGAGCATCTGACCGAAG
>probe:Drosophila_2:1637518_at:647:207; Interrogation_Position=1544; Antisense; AAGCTAGCCAGTTCCTTCAGGAGCG
>probe:Drosophila_2:1637518_at:429:123; Interrogation_Position=1585; Antisense; ACCATGGTGCACTCCGATTTCGGAA
>probe:Drosophila_2:1637518_at:355:105; Interrogation_Position=1609; Antisense; AGACTGATGACGGAGGCCCTTAACA
>probe:Drosophila_2:1637518_at:698:155; Interrogation_Position=1631; Antisense; ACACGGCCAGGATTTCCAAGTTCTA
>probe:Drosophila_2:1637518_at:468:583; Interrogation_Position=1760; Antisense; TGGTCTAACGTTCAAAATGTGCCCC

Paste this into a BLAST search page for me
TTGGGCGTGAACTACATGCAGATACGAATTGTCCGTACCGCGTGAATGTTAATGTTCGCAACTTCCAGAGGGATGGATGGTGCTATGACAGTGACTGACAAGCGGTGACACCGAGGACAATTTCAGGACAATTTCAGTCAGGTCACCGACGGACCTACACCCTGGATAACTGCGGAAGCGGCTAGTTCGCAACTTGTCCGAACTTGTCCGAGCATCTGACCGAAGAAGCTAGCCAGTTCCTTCAGGAGCGACCATGGTGCACTCCGATTTCGGAAAGACTGATGACGGAGGCCCTTAACAACACGGCCAGGATTTCCAAGTTCTATGGTCTAACGTTCAAAATGTGCCCC

Full Affymetrix probeset data:

Annotations for 1637518_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720