FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637519_at:

>probe:Drosophila_2:1637519_at:195:435; Interrogation_Position=1086; Antisense; GAGGAGGGCTTCTCCAATGAACAGT
>probe:Drosophila_2:1637519_at:195:387; Interrogation_Position=1112; Antisense; GAACAAAATCGAGCACCAACACCAT
>probe:Drosophila_2:1637519_at:78:189; Interrogation_Position=1129; Antisense; AACACCATCTCAGGCAGCAGAAACA
>probe:Drosophila_2:1637519_at:445:563; Interrogation_Position=1189; Antisense; GGAATACCCCTCTCATAAGGAACAT
>probe:Drosophila_2:1637519_at:306:57; Interrogation_Position=1219; Antisense; ATGAGGTGAGTCTGGCATTGCGCCC
>probe:Drosophila_2:1637519_at:572:575; Interrogation_Position=654; Antisense; GGCGATACCTCGAATGGCGTTGATG
>probe:Drosophila_2:1637519_at:6:329; Interrogation_Position=670; Antisense; GCGTTGATGAGGAACTGGCCCGACA
>probe:Drosophila_2:1637519_at:223:233; Interrogation_Position=695; Antisense; AATGCCCAGATATTCGCTGTTCACC
>probe:Drosophila_2:1637519_at:477:601; Interrogation_Position=712; Antisense; TGTTCACCCAGAAGTTGCCACACAT
>probe:Drosophila_2:1637519_at:670:11; Interrogation_Position=754; Antisense; ATTACAATGCGTACGACCAGTCGGA
>probe:Drosophila_2:1637519_at:247:287; Interrogation_Position=783; Antisense; CTGGACATAGTTTCGAGTAGCAATC
>probe:Drosophila_2:1637519_at:555:155; Interrogation_Position=811; Antisense; ACAGCAACAAGTATCCCAGCGTGGC
>probe:Drosophila_2:1637519_at:482:235; Interrogation_Position=837; Antisense; AATCCGCACGACAAGTCTGCTGGCA
>probe:Drosophila_2:1637519_at:593:157; Interrogation_Position=923; Antisense; ACACATCACAACTACTTCAACGACA

Paste this into a BLAST search page for me
GAGGAGGGCTTCTCCAATGAACAGTGAACAAAATCGAGCACCAACACCATAACACCATCTCAGGCAGCAGAAACAGGAATACCCCTCTCATAAGGAACATATGAGGTGAGTCTGGCATTGCGCCCGGCGATACCTCGAATGGCGTTGATGGCGTTGATGAGGAACTGGCCCGACAAATGCCCAGATATTCGCTGTTCACCTGTTCACCCAGAAGTTGCCACACATATTACAATGCGTACGACCAGTCGGACTGGACATAGTTTCGAGTAGCAATCACAGCAACAAGTATCCCAGCGTGGCAATCCGCACGACAAGTCTGCTGGCAACACATCACAACTACTTCAACGACA

Full Affymetrix probeset data:

Annotations for 1637519_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720