Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637520_at:

>probe:Drosophila_2:1637520_at:159:43; Interrogation_Position=2271; Antisense; ATCGTGGTGCGCACATCCGCGAAAA
>probe:Drosophila_2:1637520_at:500:169; Interrogation_Position=2293; Antisense; AAAGGACTACTATGCGGCCAACGGA
>probe:Drosophila_2:1637520_at:273:261; Interrogation_Position=2343; Antisense; CACCCACACTGCTCAATTGTTTGAT
>probe:Drosophila_2:1637520_at:14:443; Interrogation_Position=2374; Antisense; GATGTGCTACTATCGCTTTGGGCAA
>probe:Drosophila_2:1637520_at:532:173; Interrogation_Position=2417; Antisense; AAAGCCCAGGGCTACGATCGAGTTC
>probe:Drosophila_2:1637520_at:478:573; Interrogation_Position=2511; Antisense; GGCTGGTGCGCATCTACAAGGTTAA
>probe:Drosophila_2:1637520_at:251:545; Interrogation_Position=2536; Antisense; GGATCTGCCGAATCGTGGAGTCTGA
>probe:Drosophila_2:1637520_at:653:163; Interrogation_Position=2562; Antisense; AAATAAGTGTCGCAGTCATTCCGCT
>probe:Drosophila_2:1637520_at:714:9; Interrogation_Position=2579; Antisense; ATTCCGCTCTATTCTGTGTTCTGTA
>probe:Drosophila_2:1637520_at:234:715; Interrogation_Position=2597; Antisense; TTCTGTACATTAGCTAACTCTGCCC
>probe:Drosophila_2:1637520_at:537:497; Interrogation_Position=2622; Antisense; GTCTCCCTCTATCTCGAATATTTGG
>probe:Drosophila_2:1637520_at:49:23; Interrogation_Position=2639; Antisense; ATATTTGGCAATCTCTCTCGCTCTA
>probe:Drosophila_2:1637520_at:539:599; Interrogation_Position=2772; Antisense; TGTCTCAAGTGTACCAGATGCGTCT
>probe:Drosophila_2:1637520_at:95:99; Interrogation_Position=2787; Antisense; AGATGCGTCTGGCTTCTTAAGCAAG

Paste this into a BLAST search page for me
ATCGTGGTGCGCACATCCGCGAAAAAAAGGACTACTATGCGGCCAACGGACACCCACACTGCTCAATTGTTTGATGATGTGCTACTATCGCTTTGGGCAAAAAGCCCAGGGCTACGATCGAGTTCGGCTGGTGCGCATCTACAAGGTTAAGGATCTGCCGAATCGTGGAGTCTGAAAATAAGTGTCGCAGTCATTCCGCTATTCCGCTCTATTCTGTGTTCTGTATTCTGTACATTAGCTAACTCTGCCCGTCTCCCTCTATCTCGAATATTTGGATATTTGGCAATCTCTCTCGCTCTATGTCTCAAGTGTACCAGATGCGTCTAGATGCGTCTGGCTTCTTAAGCAAG

Full Affymetrix probeset data:

Annotations for 1637520_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime