FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637521_at:

>probe:Drosophila_2:1637521_at:483:95; Interrogation_Position=1102; Antisense; AGATTCGATGTACCCATGGACCTTT
>probe:Drosophila_2:1637521_at:13:609; Interrogation_Position=1142; Antisense; TGACCCCGTGGGATTATTTGAGCAA
>probe:Drosophila_2:1637521_at:570:357; Interrogation_Position=1163; Antisense; GCAAGTACGTCTGGGTGTCGCAACA
>probe:Drosophila_2:1637521_at:473:123; Interrogation_Position=1241; Antisense; AGCCGGAAAGCGAGTTGGCCGCCAT
>probe:Drosophila_2:1637521_at:26:163; Interrogation_Position=1291; Antisense; AAATACCGTGAGAGAACCCTCGTCT
>probe:Drosophila_2:1637521_at:211:89; Interrogation_Position=1321; Antisense; AGTCTGCCGCAAGCTCTCGAGGATG
>probe:Drosophila_2:1637521_at:624:59; Interrogation_Position=1343; Antisense; ATGTTCTGGAGTTCCATGGCACCGA
>probe:Drosophila_2:1637521_at:626:257; Interrogation_Position=1385; Antisense; CACTGAGAATGTTGGGCTACGACGC
>probe:Drosophila_2:1637521_at:642:207; Interrogation_Position=1412; Antisense; AAGCATCGGGTGACTTGGACTTCCG
>probe:Drosophila_2:1637521_at:359:565; Interrogation_Position=1447; Antisense; GGAATTGTCTCCTTCGCCGAAAGAT
>probe:Drosophila_2:1637521_at:505:3; Interrogation_Position=1470; Antisense; ATTGGCCCTAGCTGATGAATCCGGA
>probe:Drosophila_2:1637521_at:292:303; Interrogation_Position=1490; Antisense; CCGGATCGGATGATTCGTGCGACGA
>probe:Drosophila_2:1637521_at:164:579; Interrogation_Position=1524; Antisense; GGCCGATTTCAATAGCATGGAGCAA
>probe:Drosophila_2:1637521_at:285:33; Interrogation_Position=1549; Antisense; ATAATGCCAAACTTCACTGTGCCCG

Paste this into a BLAST search page for me
AGATTCGATGTACCCATGGACCTTTTGACCCCGTGGGATTATTTGAGCAAGCAAGTACGTCTGGGTGTCGCAACAAGCCGGAAAGCGAGTTGGCCGCCATAAATACCGTGAGAGAACCCTCGTCTAGTCTGCCGCAAGCTCTCGAGGATGATGTTCTGGAGTTCCATGGCACCGACACTGAGAATGTTGGGCTACGACGCAAGCATCGGGTGACTTGGACTTCCGGGAATTGTCTCCTTCGCCGAAAGATATTGGCCCTAGCTGATGAATCCGGACCGGATCGGATGATTCGTGCGACGAGGCCGATTTCAATAGCATGGAGCAAATAATGCCAAACTTCACTGTGCCCG

Full Affymetrix probeset data:

Annotations for 1637521_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720