Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637522_at:

>probe:Drosophila_2:1637522_at:352:121; Interrogation_Position=1079; Antisense; AGCGAACTCTTTCAGGTGCATGGCC
>probe:Drosophila_2:1637522_at:107:555; Interrogation_Position=1109; Antisense; GGACAGCAGCTTGAGGAGTTGACCC
>probe:Drosophila_2:1637522_at:261:93; Interrogation_Position=1125; Antisense; AGTTGACCCGGTTGCAGCGCGAGTA
>probe:Drosophila_2:1637522_at:313:175; Interrogation_Position=1161; Antisense; AAACCGCTCAGGATGAACTGCTCCG
>probe:Drosophila_2:1637522_at:161:295; Interrogation_Position=1207; Antisense; CGAACTGGCCCTTAAGAGTGACTTT
>probe:Drosophila_2:1637522_at:217:693; Interrogation_Position=1229; Antisense; TTTGTTGACCAGTTACGCGACAGCT
>probe:Drosophila_2:1637522_at:28:709; Interrogation_Position=1241; Antisense; TTACGCGACAGCTTGGCCAAAGTGC
>probe:Drosophila_2:1637522_at:608:589; Interrogation_Position=1359; Antisense; TGGTTACCCTCCAGAATTGCTTGGC
>probe:Drosophila_2:1637522_at:368:523; Interrogation_Position=1393; Antisense; GGGCCAAAGGATTCGCCAATGCTTC
>probe:Drosophila_2:1637522_at:458:171; Interrogation_Position=1422; Antisense; AAAGTCAGGCCTATCAGCATGCCAC
>probe:Drosophila_2:1637522_at:396:51; Interrogation_Position=1454; Antisense; ATGCTGCACTTTGTAGCCCACTATA
>probe:Drosophila_2:1637522_at:330:125; Interrogation_Position=1468; Antisense; AGCCCACTATATGCTACCAGGTACT
>probe:Drosophila_2:1637522_at:572:695; Interrogation_Position=1507; Antisense; TTCGCTTCCAGGAGCCGTTAACAGG
>probe:Drosophila_2:1637522_at:479:615; Interrogation_Position=1533; Antisense; TGAAGGGCTTTTTTGTACGCGGCTC

Paste this into a BLAST search page for me
AGCGAACTCTTTCAGGTGCATGGCCGGACAGCAGCTTGAGGAGTTGACCCAGTTGACCCGGTTGCAGCGCGAGTAAAACCGCTCAGGATGAACTGCTCCGCGAACTGGCCCTTAAGAGTGACTTTTTTGTTGACCAGTTACGCGACAGCTTTACGCGACAGCTTGGCCAAAGTGCTGGTTACCCTCCAGAATTGCTTGGCGGGCCAAAGGATTCGCCAATGCTTCAAAGTCAGGCCTATCAGCATGCCACATGCTGCACTTTGTAGCCCACTATAAGCCCACTATATGCTACCAGGTACTTTCGCTTCCAGGAGCCGTTAACAGGTGAAGGGCTTTTTTGTACGCGGCTC

Full Affymetrix probeset data:

Annotations for 1637522_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime