Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637523_at:

>probe:Drosophila_2:1637523_at:642:165; Interrogation_Position=1931; Antisense; AAATCCTTGCCATCGGTCAACCAGG
>probe:Drosophila_2:1637523_at:382:493; Interrogation_Position=1946; Antisense; GTCAACCAGGTAGCCCAAGCAGCTG
>probe:Drosophila_2:1637523_at:177:455; Interrogation_Position=2011; Antisense; GATCACGCAGGAACAGCCGGCAGAA
>probe:Drosophila_2:1637523_at:355:567; Interrogation_Position=2029; Antisense; GGCAGAAGTTCCACCAGTGGCCAAT
>probe:Drosophila_2:1637523_at:632:81; Interrogation_Position=2044; Antisense; AGTGGCCAATCTCTGGACAAAGGAG
>probe:Drosophila_2:1637523_at:720:289; Interrogation_Position=2155; Antisense; CGGAGGAGCACGTCGCCAGCATCTG
>probe:Drosophila_2:1637523_at:498:383; Interrogation_Position=2195; Antisense; GAACGGAATTCCACGCTGCAGCGGA
>probe:Drosophila_2:1637523_at:358:117; Interrogation_Position=2214; Antisense; AGCGGAACCGCATGCGGAGGTCTTT
>probe:Drosophila_2:1637523_at:107:729; Interrogation_Position=2237; Antisense; TTGGTGGTGGCCACTGGCCATCAGA
>probe:Drosophila_2:1637523_at:325:109; Interrogation_Position=2259; Antisense; AGAAGCTAACAACGCGCGACCAGAT
>probe:Drosophila_2:1637523_at:539:393; Interrogation_Position=2307; Antisense; GAAAGATGTGCAGTCCAGGAGCCAT
>probe:Drosophila_2:1637523_at:591:565; Interrogation_Position=2332; Antisense; GGCAACCATGGAGACTATGAGCGTT
>probe:Drosophila_2:1637523_at:146:215; Interrogation_Position=2446; Antisense; AAGATTCCAGTTTTTTCAGCTGCCA
>probe:Drosophila_2:1637523_at:304:649; Interrogation_Position=2461; Antisense; TCAGCTGCCATTCATTGTGCAATTT

Paste this into a BLAST search page for me
AAATCCTTGCCATCGGTCAACCAGGGTCAACCAGGTAGCCCAAGCAGCTGGATCACGCAGGAACAGCCGGCAGAAGGCAGAAGTTCCACCAGTGGCCAATAGTGGCCAATCTCTGGACAAAGGAGCGGAGGAGCACGTCGCCAGCATCTGGAACGGAATTCCACGCTGCAGCGGAAGCGGAACCGCATGCGGAGGTCTTTTTGGTGGTGGCCACTGGCCATCAGAAGAAGCTAACAACGCGCGACCAGATGAAAGATGTGCAGTCCAGGAGCCATGGCAACCATGGAGACTATGAGCGTTAAGATTCCAGTTTTTTCAGCTGCCATCAGCTGCCATTCATTGTGCAATTT

Full Affymetrix probeset data:

Annotations for 1637523_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime