Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637527_at:

>probe:Drosophila_2:1637527_at:453:609; Interrogation_Position=1686; Antisense; TGACCTGGAGGTGCTTCGTGCGTTC
>probe:Drosophila_2:1637527_at:603:507; Interrogation_Position=1703; Antisense; GTGCGTTCCATCAGCGCTTAAAGAA
>probe:Drosophila_2:1637527_at:673:415; Interrogation_Position=1735; Antisense; GAGCCGCTCTGGGATATGCGCCTAT
>probe:Drosophila_2:1637527_at:479:417; Interrogation_Position=1801; Antisense; GAGCGGGAATCGATCTTTTCCGAAT
>probe:Drosophila_2:1637527_at:118:363; Interrogation_Position=1822; Antisense; GAATTTAACCAACTTCTCGCTCCTT
>probe:Drosophila_2:1637527_at:41:341; Interrogation_Position=1848; Antisense; GCTAGGTGGCGGATTCTCACTGAAT
>probe:Drosophila_2:1637527_at:450:615; Interrogation_Position=1868; Antisense; TGAATGCCTCTTCCCAGCAGGATGT
>probe:Drosophila_2:1637527_at:672:429; Interrogation_Position=1888; Antisense; GATGTCCAAAAGCAACGGTCGCGGT
>probe:Drosophila_2:1637527_at:711:253; Interrogation_Position=1900; Antisense; CAACGGTCGCGGTTCATATATGTGC
>probe:Drosophila_2:1637527_at:303:23; Interrogation_Position=1917; Antisense; ATATGTGCGCGGTGTGATCTGCAAT
>probe:Drosophila_2:1637527_at:347:373; Interrogation_Position=1978; Antisense; GAAGATTCTTTTTTCAAGCCAGAGC
>probe:Drosophila_2:1637527_at:417:203; Interrogation_Position=1993; Antisense; AAGCCAGAGCTTCAGCGGTACTACC
>probe:Drosophila_2:1637527_at:370:21; Interrogation_Position=2181; Antisense; ATATTTCCGGGATGCACTCTATATC
>probe:Drosophila_2:1637527_at:722:685; Interrogation_Position=2200; Antisense; TATATCCAAACCTACTCACATCTGT

Paste this into a BLAST search page for me
TGACCTGGAGGTGCTTCGTGCGTTCGTGCGTTCCATCAGCGCTTAAAGAAGAGCCGCTCTGGGATATGCGCCTATGAGCGGGAATCGATCTTTTCCGAATGAATTTAACCAACTTCTCGCTCCTTGCTAGGTGGCGGATTCTCACTGAATTGAATGCCTCTTCCCAGCAGGATGTGATGTCCAAAAGCAACGGTCGCGGTCAACGGTCGCGGTTCATATATGTGCATATGTGCGCGGTGTGATCTGCAATGAAGATTCTTTTTTCAAGCCAGAGCAAGCCAGAGCTTCAGCGGTACTACCATATTTCCGGGATGCACTCTATATCTATATCCAAACCTACTCACATCTGT

Full Affymetrix probeset data:

Annotations for 1637527_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime