FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637531_at:

>probe:Drosophila_2:1637531_at:8:79; Interrogation_Position=1305; Antisense; AGGTTAGCAAGCGATTCGCCTCCAA
>probe:Drosophila_2:1637531_at:658:9; Interrogation_Position=1318; Antisense; ATTCGCCTCCAAGCAGGGCATCGAG
>probe:Drosophila_2:1637531_at:556:505; Interrogation_Position=1352; Antisense; GTCCACGATTTTAAGCTGGTCTTCG
>probe:Drosophila_2:1637531_at:467:175; Interrogation_Position=1389; Antisense; AAACGACATTCTCCAAGGCAGACCG
>probe:Drosophila_2:1637531_at:387:315; Interrogation_Position=1413; Antisense; GCCTGATCTACGGTGAATCGGCCAT
>probe:Drosophila_2:1637531_at:682:55; Interrogation_Position=1436; Antisense; ATGACCCATGCCATGGTTTTCACCG
>probe:Drosophila_2:1637531_at:459:701; Interrogation_Position=1452; Antisense; TTTTCACCGCCGTATCCGTGGATAA
>probe:Drosophila_2:1637531_at:111:31; Interrogation_Position=1473; Antisense; ATAAGAGCGGCGTGGCCCAGAAATT
>probe:Drosophila_2:1637531_at:615:689; Interrogation_Position=1574; Antisense; TTTGGATTCGAGGTGGTCGTCGACA
>probe:Drosophila_2:1637531_at:2:219; Interrogation_Position=1601; Antisense; AAGTACGTGCCCGAGGATGTGTTGC
>probe:Drosophila_2:1637531_at:594:513; Interrogation_Position=1619; Antisense; GTGTTGCGCGTGTTCGACATGGATC
>probe:Drosophila_2:1637531_at:27:401; Interrogation_Position=1634; Antisense; GACATGGATCCGATCGTACTGCCTG
>probe:Drosophila_2:1637531_at:703:449; Interrogation_Position=1664; Antisense; GATCCCATGGGTACGCTAGCACAGT
>probe:Drosophila_2:1637531_at:45:259; Interrogation_Position=1683; Antisense; CACAGTAGGTCCAGGTTGCCATCAA

Paste this into a BLAST search page for me
AGGTTAGCAAGCGATTCGCCTCCAAATTCGCCTCCAAGCAGGGCATCGAGGTCCACGATTTTAAGCTGGTCTTCGAAACGACATTCTCCAAGGCAGACCGGCCTGATCTACGGTGAATCGGCCATATGACCCATGCCATGGTTTTCACCGTTTTCACCGCCGTATCCGTGGATAAATAAGAGCGGCGTGGCCCAGAAATTTTTGGATTCGAGGTGGTCGTCGACAAAGTACGTGCCCGAGGATGTGTTGCGTGTTGCGCGTGTTCGACATGGATCGACATGGATCCGATCGTACTGCCTGGATCCCATGGGTACGCTAGCACAGTCACAGTAGGTCCAGGTTGCCATCAA

Full Affymetrix probeset data:

Annotations for 1637531_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720