FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637534_at:

>probe:Drosophila_2:1637534_at:12:253; Interrogation_Position=1034; Antisense; CAAGTGCCTGCGAAAAACTGTTTTA
>probe:Drosophila_2:1637534_at:82:539; Interrogation_Position=1177; Antisense; GGTCACAAATTTTCAGCGTGCGTGT
>probe:Drosophila_2:1637534_at:707:413; Interrogation_Position=682; Antisense; GAGCCGCCGTATCAGTTAGTTGTTA
>probe:Drosophila_2:1637534_at:162:679; Interrogation_Position=698; Antisense; TAGTTGTTAACTTGCCATCGCCGAA
>probe:Drosophila_2:1637534_at:583:165; Interrogation_Position=764; Antisense; AAATCGAATCGAATGTGCACCGCGC
>probe:Drosophila_2:1637534_at:103:613; Interrogation_Position=779; Antisense; TGCACCGCGCACCTGAATTAAATTC
>probe:Drosophila_2:1637534_at:303:11; Interrogation_Position=827; Antisense; ATTCGATTCGTCGTTTTTCTTGCGT
>probe:Drosophila_2:1637534_at:74:701; Interrogation_Position=840; Antisense; TTTTTCTTGCGTGGCTCTTATTTTT
>probe:Drosophila_2:1637534_at:136:563; Interrogation_Position=878; Antisense; GGAAGTGTCGCCAGCATCCGCGACT
>probe:Drosophila_2:1637534_at:488:403; Interrogation_Position=899; Antisense; GACTGTTTTCCGTTTCAGTTCCTAG
>probe:Drosophila_2:1637534_at:77:93; Interrogation_Position=915; Antisense; AGTTCCTAGCTTTTCGTGCTTTCCT
>probe:Drosophila_2:1637534_at:263:695; Interrogation_Position=934; Antisense; TTTCCTCTCAGCTAGCAGTCGTTAG
>probe:Drosophila_2:1637534_at:582:493; Interrogation_Position=951; Antisense; GTCGTTAGGGTACAACTCTTGGCTT
>probe:Drosophila_2:1637534_at:128:159; Interrogation_Position=962; Antisense; ACAACTCTTGGCTTCGGTCATATGA

Paste this into a BLAST search page for me
CAAGTGCCTGCGAAAAACTGTTTTAGGTCACAAATTTTCAGCGTGCGTGTGAGCCGCCGTATCAGTTAGTTGTTATAGTTGTTAACTTGCCATCGCCGAAAAATCGAATCGAATGTGCACCGCGCTGCACCGCGCACCTGAATTAAATTCATTCGATTCGTCGTTTTTCTTGCGTTTTTTCTTGCGTGGCTCTTATTTTTGGAAGTGTCGCCAGCATCCGCGACTGACTGTTTTCCGTTTCAGTTCCTAGAGTTCCTAGCTTTTCGTGCTTTCCTTTTCCTCTCAGCTAGCAGTCGTTAGGTCGTTAGGGTACAACTCTTGGCTTACAACTCTTGGCTTCGGTCATATGA

Full Affymetrix probeset data:

Annotations for 1637534_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720