Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637537_at:

>probe:Drosophila_2:1637537_at:338:611; Interrogation_Position=7022; Antisense; TGACGAACCTTATGGACTGATCGAT
>probe:Drosophila_2:1637537_at:710:143; Interrogation_Position=7037; Antisense; ACTGATCGATGTCTTGGTAGCTAAC
>probe:Drosophila_2:1637537_at:208:537; Interrogation_Position=7052; Antisense; GGTAGCTAACAGACAGTTCAAATTT
>probe:Drosophila_2:1637537_at:1:459; Interrogation_Position=7090; Antisense; GATAGATCACATACGCAACTTCCAG
>probe:Drosophila_2:1637537_at:347:255; Interrogation_Position=7105; Antisense; CAACTTCCAGCCAAGCAGCTATTTT
>probe:Drosophila_2:1637537_at:114:687; Interrogation_Position=7124; Antisense; TATTTTAACTTCAACCTCATTCCCT
>probe:Drosophila_2:1637537_at:144:619; Interrogation_Position=7148; Antisense; TCGACTTCTATTCAGTTCCCTAGTA
>probe:Drosophila_2:1637537_at:545:265; Interrogation_Position=7160; Antisense; CAGTTCCCTAGTACATTCCTGTATA
>probe:Drosophila_2:1637537_at:574:719; Interrogation_Position=7175; Antisense; TTCCTGTATATACCACAGTCGATAC
>probe:Drosophila_2:1637537_at:376:131; Interrogation_Position=7198; Antisense; ACCCGAGCTAGCCACTTATGTATGT
>probe:Drosophila_2:1637537_at:694:401; Interrogation_Position=7274; Antisense; GACATAGAGAATAACCGAGCGAACA
>probe:Drosophila_2:1637537_at:585:161; Interrogation_Position=7350; Antisense; AAATAGAGCGACACACGCGGTTATA
>probe:Drosophila_2:1637537_at:43:275; Interrogation_Position=7400; Antisense; CATTGGCAATAGTTCTTAAGGTACA
>probe:Drosophila_2:1637537_at:278:363; Interrogation_Position=7466; Antisense; GAATTCGGCCTCGTAACTATACATA

Paste this into a BLAST search page for me
TGACGAACCTTATGGACTGATCGATACTGATCGATGTCTTGGTAGCTAACGGTAGCTAACAGACAGTTCAAATTTGATAGATCACATACGCAACTTCCAGCAACTTCCAGCCAAGCAGCTATTTTTATTTTAACTTCAACCTCATTCCCTTCGACTTCTATTCAGTTCCCTAGTACAGTTCCCTAGTACATTCCTGTATATTCCTGTATATACCACAGTCGATACACCCGAGCTAGCCACTTATGTATGTGACATAGAGAATAACCGAGCGAACAAAATAGAGCGACACACGCGGTTATACATTGGCAATAGTTCTTAAGGTACAGAATTCGGCCTCGTAACTATACATA

Full Affymetrix probeset data:

Annotations for 1637537_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime