Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637540_at:

>probe:Drosophila_2:1637540_at:585:605; Interrogation_Position=1405; Antisense; TGATCCATCTTGATCGGCTGACCGA
>probe:Drosophila_2:1637540_at:276:137; Interrogation_Position=1465; Antisense; ACGAGCGCGGAATCAGTCTGTTTTT
>probe:Drosophila_2:1637540_at:312:477; Interrogation_Position=1484; Antisense; GTTTTTACCCATTCCTCAGAATCGA
>probe:Drosophila_2:1637540_at:572:155; Interrogation_Position=1560; Antisense; AAATCGGTATCCACCCACGAAAGTG
>probe:Drosophila_2:1637540_at:560:505; Interrogation_Position=1582; Antisense; GTGCCATTCAAGAGGCTGCCAGTTT
>probe:Drosophila_2:1637540_at:224:267; Interrogation_Position=1609; Antisense; CAGTGGACAGGATCAACGAGCTCAT
>probe:Drosophila_2:1637540_at:572:645; Interrogation_Position=1630; Antisense; TCATCAAGCCATATCCTCAGTGTAG
>probe:Drosophila_2:1637540_at:123:463; Interrogation_Position=1656; Antisense; GTTCTAAGCCTACAATCGGTTCGCA
>probe:Drosophila_2:1637540_at:540:503; Interrogation_Position=1727; Antisense; GTCCCAGGTTATGGTCCGCTTGAAA
>probe:Drosophila_2:1637540_at:396:439; Interrogation_Position=1764; Antisense; GATGGAAACTTCGATGCCACCGTTC
>probe:Drosophila_2:1637540_at:468:313; Interrogation_Position=1779; Antisense; GCCACCGTTCTCATAACAATGCTTA
>probe:Drosophila_2:1637540_at:180:75; Interrogation_Position=1845; Antisense; AGGACAGACAGATACGCCCATCAGG
>probe:Drosophila_2:1637540_at:422:69; Interrogation_Position=1867; Antisense; AGGCGTACTGCGTTCAAAACTATCG
>probe:Drosophila_2:1637540_at:133:489; Interrogation_Position=1901; Antisense; GTACTGCTATTGCTTATGATCGATC

Paste this into a BLAST search page for me
TGATCCATCTTGATCGGCTGACCGAACGAGCGCGGAATCAGTCTGTTTTTGTTTTTACCCATTCCTCAGAATCGAAAATCGGTATCCACCCACGAAAGTGGTGCCATTCAAGAGGCTGCCAGTTTCAGTGGACAGGATCAACGAGCTCATTCATCAAGCCATATCCTCAGTGTAGGTTCTAAGCCTACAATCGGTTCGCAGTCCCAGGTTATGGTCCGCTTGAAAGATGGAAACTTCGATGCCACCGTTCGCCACCGTTCTCATAACAATGCTTAAGGACAGACAGATACGCCCATCAGGAGGCGTACTGCGTTCAAAACTATCGGTACTGCTATTGCTTATGATCGATC

Full Affymetrix probeset data:

Annotations for 1637540_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime