FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637543_at:

>probe:Drosophila_2:1637543_at:63:141; Interrogation_Position=1016; Antisense; ACGGGAAGCCACTTTGCATCTTTAA
>probe:Drosophila_2:1637543_at:93:53; Interrogation_Position=1054; Antisense; ATGCATCCTGTACCTTTGCACAGTA
>probe:Drosophila_2:1637543_at:390:515; Interrogation_Position=1091; Antisense; GGGCTTTCGTTTCCAACTATAGCAT
>probe:Drosophila_2:1637543_at:556:61; Interrogation_Position=1119; Antisense; ATGTCTGCCGCCAAGGAAGCATTTT
>probe:Drosophila_2:1637543_at:676:315; Interrogation_Position=583; Antisense; GCCTTCTTCCTCAAGTGTGATGACG
>probe:Drosophila_2:1637543_at:577:61; Interrogation_Position=620; Antisense; ATGTGCCAAATCTACTCCATTTTCT
>probe:Drosophila_2:1637543_at:704:627; Interrogation_Position=635; Antisense; TCCATTTTCTGCTGGGCGGTACAAT
>probe:Drosophila_2:1637543_at:329:457; Interrogation_Position=673; Antisense; GATACGGTGGGCTATCACTCGCGCA
>probe:Drosophila_2:1637543_at:458:501; Interrogation_Position=784; Antisense; GTCGACGACGTGAAGAGCCCTTGGT
>probe:Drosophila_2:1637543_at:190:123; Interrogation_Position=799; Antisense; AGCCCTTGGTACATGCCGTATTATA
>probe:Drosophila_2:1637543_at:169:487; Interrogation_Position=860; Antisense; GTACCGGCTATCTGATGTCCATCGA
>probe:Drosophila_2:1637543_at:206:639; Interrogation_Position=947; Antisense; TCGTCACTGGCATCTGTGCGAAGAA
>probe:Drosophila_2:1637543_at:260:393; Interrogation_Position=969; Antisense; GAAAGCTGGAATCCGGCGACGTCAT
>probe:Drosophila_2:1637543_at:140:297; Interrogation_Position=985; Antisense; CGACGTCATCAACCACTTTTTAACT

Paste this into a BLAST search page for me
ACGGGAAGCCACTTTGCATCTTTAAATGCATCCTGTACCTTTGCACAGTAGGGCTTTCGTTTCCAACTATAGCATATGTCTGCCGCCAAGGAAGCATTTTGCCTTCTTCCTCAAGTGTGATGACGATGTGCCAAATCTACTCCATTTTCTTCCATTTTCTGCTGGGCGGTACAATGATACGGTGGGCTATCACTCGCGCAGTCGACGACGTGAAGAGCCCTTGGTAGCCCTTGGTACATGCCGTATTATAGTACCGGCTATCTGATGTCCATCGATCGTCACTGGCATCTGTGCGAAGAAGAAAGCTGGAATCCGGCGACGTCATCGACGTCATCAACCACTTTTTAACT

Full Affymetrix probeset data:

Annotations for 1637543_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720