FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637545_at:

>probe:Drosophila_2:1637545_at:379:9; Interrogation_Position=1187; Antisense; ATTGCCAAGGTTGACTGCACGGCGC
>probe:Drosophila_2:1637545_at:263:221; Interrogation_Position=1224; Antisense; AAGTGTGCATCGACCAGCAGGTGGA
>probe:Drosophila_2:1637545_at:477:81; Interrogation_Position=1242; Antisense; AGGTGGAGGGCTATCCAACTCTCTT
>probe:Drosophila_2:1637545_at:263:383; Interrogation_Position=1291; Antisense; GAACGAGTACGAAGGCAGCCGCTCA
>probe:Drosophila_2:1637545_at:21:579; Interrogation_Position=1352; Antisense; GGCCACGACGAGCTCTAAAGCATCT
>probe:Drosophila_2:1637545_at:677:207; Interrogation_Position=1369; Antisense; AAGCATCTGCCGGTTCACAGGGAAT
>probe:Drosophila_2:1637545_at:566:605; Interrogation_Position=1408; Antisense; TGATCAAATAATCGCCCGCCAAATT
>probe:Drosophila_2:1637545_at:524:493; Interrogation_Position=1437; Antisense; GTAATCGTAATTTTTCTTTCTCCAG
>probe:Drosophila_2:1637545_at:379:277; Interrogation_Position=1452; Antisense; CTTTCTCCAGCATAAACCTCTGTGA
>probe:Drosophila_2:1637545_at:98:201; Interrogation_Position=1466; Antisense; AACCTCTGTGAGGAGTCCGCATTTA
>probe:Drosophila_2:1637545_at:38:137; Interrogation_Position=1515; Antisense; ACGACAACGCGCTAGCTGAAATTGA
>probe:Drosophila_2:1637545_at:112:301; Interrogation_Position=1582; Antisense; CCCTCTTCCTTAGCTGTTTTTGTAG
>probe:Drosophila_2:1637545_at:66:407; Interrogation_Position=1655; Antisense; GACTGTGTGCGCGATGATAAGCCAT
>probe:Drosophila_2:1637545_at:310:217; Interrogation_Position=1705; Antisense; AAGTCATTTTGAGTAGCCTACGTTT

Paste this into a BLAST search page for me
ATTGCCAAGGTTGACTGCACGGCGCAAGTGTGCATCGACCAGCAGGTGGAAGGTGGAGGGCTATCCAACTCTCTTGAACGAGTACGAAGGCAGCCGCTCAGGCCACGACGAGCTCTAAAGCATCTAAGCATCTGCCGGTTCACAGGGAATTGATCAAATAATCGCCCGCCAAATTGTAATCGTAATTTTTCTTTCTCCAGCTTTCTCCAGCATAAACCTCTGTGAAACCTCTGTGAGGAGTCCGCATTTAACGACAACGCGCTAGCTGAAATTGACCCTCTTCCTTAGCTGTTTTTGTAGGACTGTGTGCGCGATGATAAGCCATAAGTCATTTTGAGTAGCCTACGTTT

Full Affymetrix probeset data:

Annotations for 1637545_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720