Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637546_at:

>probe:Drosophila_2:1637546_at:662:443; Interrogation_Position=1072; Antisense; GATGATATGGGTTTCGGTCTGTTCG
>probe:Drosophila_2:1637546_at:323:537; Interrogation_Position=1087; Antisense; GGTCTGTTCGACTAAGCTGGATCCC
>probe:Drosophila_2:1637546_at:230:589; Interrogation_Position=1104; Antisense; TGGATCCCGATTGCAGAATGCCCTC
>probe:Drosophila_2:1637546_at:245:637; Interrogation_Position=1166; Antisense; TTACCCACTAAGACCCTTTGTTATG
>probe:Drosophila_2:1637546_at:480:701; Interrogation_Position=1206; Antisense; TTATTGCCGCGGTTTGACGGACCCA
>probe:Drosophila_2:1637546_at:494:407; Interrogation_Position=1221; Antisense; GACGGACCCAATGGCGAGTTGCATT
>probe:Drosophila_2:1637546_at:61:179; Interrogation_Position=1246; Antisense; AAACATGCTGTAAACTGCTCGAAAG
>probe:Drosophila_2:1637546_at:489:275; Interrogation_Position=693; Antisense; CTTCTCGTACGGTCTGATTGTCAAC
>probe:Drosophila_2:1637546_at:210:465; Interrogation_Position=708; Antisense; GATTGTCAACCAGGTCTACGACTCC
>probe:Drosophila_2:1637546_at:102:551; Interrogation_Position=750; Antisense; GGAGATCCTGGACATCAAGCCCGAG
>probe:Drosophila_2:1637546_at:181:625; Interrogation_Position=779; Antisense; TGCGCGCCAAGTTCCAACAGGGAGT
>probe:Drosophila_2:1637546_at:269:357; Interrogation_Position=861; Antisense; GCACAGCATTGCCAACGGATTCAAG
>probe:Drosophila_2:1637546_at:505:223; Interrogation_Position=925; Antisense; AAGGAGGCGACCACCATCAAGGAGT
>probe:Drosophila_2:1637546_at:215:431; Interrogation_Position=946; Antisense; GAGTACATCAAGGACCCCAGCAAGT

Paste this into a BLAST search page for me
GATGATATGGGTTTCGGTCTGTTCGGGTCTGTTCGACTAAGCTGGATCCCTGGATCCCGATTGCAGAATGCCCTCTTACCCACTAAGACCCTTTGTTATGTTATTGCCGCGGTTTGACGGACCCAGACGGACCCAATGGCGAGTTGCATTAAACATGCTGTAAACTGCTCGAAAGCTTCTCGTACGGTCTGATTGTCAACGATTGTCAACCAGGTCTACGACTCCGGAGATCCTGGACATCAAGCCCGAGTGCGCGCCAAGTTCCAACAGGGAGTGCACAGCATTGCCAACGGATTCAAGAAGGAGGCGACCACCATCAAGGAGTGAGTACATCAAGGACCCCAGCAAGT

Full Affymetrix probeset data:

Annotations for 1637546_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime