FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637547_at:

>probe:Drosophila_2:1637547_at:289:655; Interrogation_Position=1166; Antisense; TAAGCGCTACATGGTGCACAAAGGC
>probe:Drosophila_2:1637547_at:409:227; Interrogation_Position=1186; Antisense; AAGGCTGGTTTGACGAGACTGTCGA
>probe:Drosophila_2:1637547_at:256:615; Interrogation_Position=1246; Antisense; TGAAGCAGATCGCAGTGTCCGAGAA
>probe:Drosophila_2:1637547_at:105:391; Interrogation_Position=1271; Antisense; GAAACTCAAGCCCAACTGGCGTGAG
>probe:Drosophila_2:1637547_at:432:607; Interrogation_Position=1292; Antisense; TGAGATGTTCGAAGGCGTCTACGCG
>probe:Drosophila_2:1637547_at:176:499; Interrogation_Position=1308; Antisense; GTCTACGCGGAGATGCCGGATCATT
>probe:Drosophila_2:1637547_at:272:545; Interrogation_Position=1325; Antisense; GGATCATTTGATTGAGCAGCGTAGC
>probe:Drosophila_2:1637547_at:720:673; Interrogation_Position=1364; Antisense; TATCGAGGCCCACAAGGAGCACTAT
>probe:Drosophila_2:1637547_at:8:553; Interrogation_Position=1379; Antisense; GGAGCACTATCCCTTGAAGGACTTT
>probe:Drosophila_2:1637547_at:11:541; Interrogation_Position=1525; Antisense; GGTTCAACCCGTTTGTTATGACTCA
>probe:Drosophila_2:1637547_at:292:55; Interrogation_Position=1542; Antisense; ATGACTCATCTGTACAGGTGGGTCG
>probe:Drosophila_2:1637547_at:411:713; Interrogation_Position=1598; Antisense; TTGGGTTTTCTCTGACCAACGAAGA
>probe:Drosophila_2:1637547_at:357:187; Interrogation_Position=1628; Antisense; AACTTGGTTGCATCCTAGGTCTTAA
>probe:Drosophila_2:1637547_at:385:131; Interrogation_Position=1670; Antisense; ACCCACTCTGGTGCAGGTGTTATGA

Paste this into a BLAST search page for me
TAAGCGCTACATGGTGCACAAAGGCAAGGCTGGTTTGACGAGACTGTCGATGAAGCAGATCGCAGTGTCCGAGAAGAAACTCAAGCCCAACTGGCGTGAGTGAGATGTTCGAAGGCGTCTACGCGGTCTACGCGGAGATGCCGGATCATTGGATCATTTGATTGAGCAGCGTAGCTATCGAGGCCCACAAGGAGCACTATGGAGCACTATCCCTTGAAGGACTTTGGTTCAACCCGTTTGTTATGACTCAATGACTCATCTGTACAGGTGGGTCGTTGGGTTTTCTCTGACCAACGAAGAAACTTGGTTGCATCCTAGGTCTTAAACCCACTCTGGTGCAGGTGTTATGA

Full Affymetrix probeset data:

Annotations for 1637547_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720