FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637548_at:

>probe:Drosophila_2:1637548_at:200:97; Interrogation_Position=1023; Antisense; AGATCAACCCAAAGCTAGGCAGCGA
>probe:Drosophila_2:1637548_at:177:589; Interrogation_Position=1068; Antisense; TGGAGTCCGGCCTGGAGATACTGAA
>probe:Drosophila_2:1637548_at:31:613; Interrogation_Position=1089; Antisense; TGAAGAGCATGTTCGGTTACCGGCG
>probe:Drosophila_2:1637548_at:496:421; Interrogation_Position=1126; Antisense; GAGCAACATCGATACCGGAATCCTT
>probe:Drosophila_2:1637548_at:607:453; Interrogation_Position=713; Antisense; GATCAGCTGGTTTACATCGGACTCC
>probe:Drosophila_2:1637548_at:3:151; Interrogation_Position=741; Antisense; ACATTGACCCCTACGAGGCGTTCAT
>probe:Drosophila_2:1637548_at:500:249; Interrogation_Position=795; Antisense; CAATGGATACCATCGACCGGGTGGG
>probe:Drosophila_2:1637548_at:307:595; Interrogation_Position=816; Antisense; TGGGCGTGCCCAAGATTATCGAGAT
>probe:Drosophila_2:1637548_at:121:411; Interrogation_Position=848; Antisense; GACGCCCTTAATCCGCAGAACAAGA
>probe:Drosophila_2:1637548_at:482:387; Interrogation_Position=865; Antisense; GAACAAGATCCACGTCAGCTTTGAC
>probe:Drosophila_2:1637548_at:579:611; Interrogation_Position=886; Antisense; TGACATCGACGCCTTGGACAGCAAT
>probe:Drosophila_2:1637548_at:135:587; Interrogation_Position=900; Antisense; TGGACAGCAATGTGGCGCCTAGCAC
>probe:Drosophila_2:1637548_at:99:651; Interrogation_Position=948; Antisense; TCACGCTCCGCGAGGGAATCAGCAT
>probe:Drosophila_2:1637548_at:710:365; Interrogation_Position=963; Antisense; GAATCAGCATCGTGGAGGCACTCCG

Paste this into a BLAST search page for me
AGATCAACCCAAAGCTAGGCAGCGATGGAGTCCGGCCTGGAGATACTGAATGAAGAGCATGTTCGGTTACCGGCGGAGCAACATCGATACCGGAATCCTTGATCAGCTGGTTTACATCGGACTCCACATTGACCCCTACGAGGCGTTCATCAATGGATACCATCGACCGGGTGGGTGGGCGTGCCCAAGATTATCGAGATGACGCCCTTAATCCGCAGAACAAGAGAACAAGATCCACGTCAGCTTTGACTGACATCGACGCCTTGGACAGCAATTGGACAGCAATGTGGCGCCTAGCACTCACGCTCCGCGAGGGAATCAGCATGAATCAGCATCGTGGAGGCACTCCG

Full Affymetrix probeset data:

Annotations for 1637548_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720