Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637549_at:

>probe:Drosophila_2:1637549_at:697:371; Interrogation_Position=108; Antisense; GAAGGACTCCGCATTGCAGAGCTGT
>probe:Drosophila_2:1637549_at:461:7; Interrogation_Position=120; Antisense; ATTGCAGAGCTGTGCGCGCATTCAA
>probe:Drosophila_2:1637549_at:375:187; Interrogation_Position=157; Antisense; AACACGTTCTTTTGCCTGGACGATA
>probe:Drosophila_2:1637549_at:251:455; Interrogation_Position=195; Antisense; GATCAAACTGGATGTGGCCCACATG
>probe:Drosophila_2:1637549_at:273:153; Interrogation_Position=215; Antisense; ACATGTATTGCTTCCCATTTCACAT
>probe:Drosophila_2:1637549_at:567:629; Interrogation_Position=239; Antisense; TCCAGCTGCCGGATGATCTGATGCA
>probe:Drosophila_2:1637549_at:196:443; Interrogation_Position=285; Antisense; GATGACCAATGGCTTTCTGAACGAT
>probe:Drosophila_2:1637549_at:284:641; Interrogation_Position=300; Antisense; TCTGAACGATATCCTTCGCACACGA
>probe:Drosophila_2:1637549_at:71:37; Interrogation_Position=331; Antisense; ATCATCCACTATACCTTTGGCTCTA
>probe:Drosophila_2:1637549_at:713:521; Interrogation_Position=360; Antisense; GGGCCATCGTCTCAATTGTGGATAT
>probe:Drosophila_2:1637549_at:543:519; Interrogation_Position=377; Antisense; GTGGATATTTGTTGCCGAATCTCCT
>probe:Drosophila_2:1637549_at:84:643; Interrogation_Position=417; Antisense; TCTCCTGCCATCGATGATGAGTCGT
>probe:Drosophila_2:1637549_at:289:707; Interrogation_Position=44; Antisense; TTAAGACCGGCGAACCATATTCCCT
>probe:Drosophila_2:1637549_at:373:207; Interrogation_Position=78; Antisense; AAGCTCCTTGGATCATGTGCTTCTG

Paste this into a BLAST search page for me
GAAGGACTCCGCATTGCAGAGCTGTATTGCAGAGCTGTGCGCGCATTCAAAACACGTTCTTTTGCCTGGACGATAGATCAAACTGGATGTGGCCCACATGACATGTATTGCTTCCCATTTCACATTCCAGCTGCCGGATGATCTGATGCAGATGACCAATGGCTTTCTGAACGATTCTGAACGATATCCTTCGCACACGAATCATCCACTATACCTTTGGCTCTAGGGCCATCGTCTCAATTGTGGATATGTGGATATTTGTTGCCGAATCTCCTTCTCCTGCCATCGATGATGAGTCGTTTAAGACCGGCGAACCATATTCCCTAAGCTCCTTGGATCATGTGCTTCTG

Full Affymetrix probeset data:

Annotations for 1637549_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime