FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637550_at:

>probe:Drosophila_2:1637550_at:672:311; Interrogation_Position=1063; Antisense; GCCAGGAACGTGCTCCTTGTGGATA
>probe:Drosophila_2:1637550_at:535:449; Interrogation_Position=571; Antisense; GATCCCATCTTGATGTTCCAACGAA
>probe:Drosophila_2:1637550_at:321:113; Interrogation_Position=596; Antisense; AGCACTATTATATCCTCATGCCGCT
>probe:Drosophila_2:1637550_at:193:609; Interrogation_Position=635; Antisense; TGCCCACCGTTATTCCAATGGTTTA
>probe:Drosophila_2:1637550_at:669:707; Interrogation_Position=657; Antisense; TTACTGGAATGAGACGCTGGCCTCC
>probe:Drosophila_2:1637550_at:613:595; Interrogation_Position=701; Antisense; TGTTCAGGTGGTGCTTCCAGCTAAA
>probe:Drosophila_2:1637550_at:121:187; Interrogation_Position=742; Antisense; AACAGCGCGGCCCATAAATTCGGAA
>probe:Drosophila_2:1637550_at:395:395; Interrogation_Position=764; Antisense; GAAATCGCCCATACGACAAGACCAT
>probe:Drosophila_2:1637550_at:79:55; Interrogation_Position=787; Antisense; ATGAATCCTACCCAGAATGCCTTTG
>probe:Drosophila_2:1637550_at:30:109; Interrogation_Position=800; Antisense; AGAATGCCTTTGTATCGGCCTTCAC
>probe:Drosophila_2:1637550_at:398:521; Interrogation_Position=837; Antisense; GTGGCACAACTACCATCACGCGTTT
>probe:Drosophila_2:1637550_at:664:649; Interrogation_Position=852; Antisense; TCACGCGTTTCCGTGGGACTACAAG
>probe:Drosophila_2:1637550_at:478:539; Interrogation_Position=889; Antisense; GGTTGCTACTCCCTGAATATAACGA
>probe:Drosophila_2:1637550_at:320:685; Interrogation_Position=906; Antisense; TATAACGACGGCCTTCATCGACTTG

Paste this into a BLAST search page for me
GCCAGGAACGTGCTCCTTGTGGATAGATCCCATCTTGATGTTCCAACGAAAGCACTATTATATCCTCATGCCGCTTGCCCACCGTTATTCCAATGGTTTATTACTGGAATGAGACGCTGGCCTCCTGTTCAGGTGGTGCTTCCAGCTAAAAACAGCGCGGCCCATAAATTCGGAAGAAATCGCCCATACGACAAGACCATATGAATCCTACCCAGAATGCCTTTGAGAATGCCTTTGTATCGGCCTTCACGTGGCACAACTACCATCACGCGTTTTCACGCGTTTCCGTGGGACTACAAGGGTTGCTACTCCCTGAATATAACGATATAACGACGGCCTTCATCGACTTG

Full Affymetrix probeset data:

Annotations for 1637550_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720