Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637551_at:

>probe:Drosophila_2:1637551_at:690:47; Interrogation_Position=1003; Antisense; ATCCAGATCTTCTCAATTCCGTGGA
>probe:Drosophila_2:1637551_at:545:251; Interrogation_Position=1142; Antisense; CAAGGACGTCTATCCAGTGCGTGAT
>probe:Drosophila_2:1637551_at:567:507; Interrogation_Position=1158; Antisense; GTGCGTGATTTTCGAGACTTTGTCT
>probe:Drosophila_2:1637551_at:421:105; Interrogation_Position=1172; Antisense; AGACTTTGTCTTTCCGGTCATGTGG
>probe:Drosophila_2:1637551_at:46:101; Interrogation_Position=1202; Antisense; AGAGGGCATCTCTGAGCTGACACCT
>probe:Drosophila_2:1637551_at:569:253; Interrogation_Position=1232; Antisense; CAAGCGCTGGATTTATTTGGGCACA
>probe:Drosophila_2:1637551_at:428:45; Interrogation_Position=1299; Antisense; ATCCTGGGCGGAGCCTTTGCCATTA
>probe:Drosophila_2:1637551_at:386:695; Interrogation_Position=1314; Antisense; TTTGCCATTATCTTCAGCTTCGTGC
>probe:Drosophila_2:1637551_at:396:507; Interrogation_Position=1335; Antisense; GTGCGGGCCTACCAGAACTTTATGT
>probe:Drosophila_2:1637551_at:490:107; Interrogation_Position=1348; Antisense; AGAACTTTATGTTCGCCCAGGATCC
>probe:Drosophila_2:1637551_at:507:45; Interrogation_Position=1369; Antisense; ATCCCACGCTGGAGATCCTCGAGAT
>probe:Drosophila_2:1637551_at:175:91; Interrogation_Position=1419; Antisense; AGTAGTTTCATAGCCCATCAGCAGC
>probe:Drosophila_2:1637551_at:161:715; Interrogation_Position=1450; Antisense; TTCTCGTTCATCATCGGGACAGCTA
>probe:Drosophila_2:1637551_at:429:307; Interrogation_Position=1543; Antisense; CCATCATCGATGTCAGCCTGAGTGG

Paste this into a BLAST search page for me
ATCCAGATCTTCTCAATTCCGTGGACAAGGACGTCTATCCAGTGCGTGATGTGCGTGATTTTCGAGACTTTGTCTAGACTTTGTCTTTCCGGTCATGTGGAGAGGGCATCTCTGAGCTGACACCTCAAGCGCTGGATTTATTTGGGCACAATCCTGGGCGGAGCCTTTGCCATTATTTGCCATTATCTTCAGCTTCGTGCGTGCGGGCCTACCAGAACTTTATGTAGAACTTTATGTTCGCCCAGGATCCATCCCACGCTGGAGATCCTCGAGATAGTAGTTTCATAGCCCATCAGCAGCTTCTCGTTCATCATCGGGACAGCTACCATCATCGATGTCAGCCTGAGTGG

Full Affymetrix probeset data:

Annotations for 1637551_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime